ID: 900762705

View in Genome Browser
Species Human (GRCh38)
Location 1:4483572-4483594
Sequence CAACACACCTCCAGCCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900762705_900762714 21 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762714 1:4483616-4483638 TGAGTCCAGGGCACTTCAGGAGG No data
900762705_900762715 22 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762715 1:4483617-4483639 GAGTCCAGGGCACTTCAGGAGGG No data
900762705_900762717 24 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762717 1:4483619-4483641 GTCCAGGGCACTTCAGGAGGGGG No data
900762705_900762713 18 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762713 1:4483613-4483635 GGCTGAGTCCAGGGCACTTCAGG No data
900762705_900762709 9 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762709 1:4483604-4483626 AGCCCCAAAGGCTGAGTCCAGGG No data
900762705_900762708 8 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762708 1:4483603-4483625 AAGCCCCAAAGGCTGAGTCCAGG No data
900762705_900762719 30 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762719 1:4483625-4483647 GGCACTTCAGGAGGGGGAATAGG No data
900762705_900762707 -3 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762707 1:4483592-4483614 TTGTCTAAACTAAGCCCCAAAGG No data
900762705_900762716 23 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762716 1:4483618-4483640 AGTCCAGGGCACTTCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900762705 Original CRISPR CAACACACCTCCAGCCCCCC GGG (reversed) Intergenic
No off target data available for this crispr