ID: 900762710

View in Genome Browser
Species Human (GRCh38)
Location 1:4483606-4483628
Sequence TGCCCTGGACTCAGCCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900762710_900762721 9 Left 900762710 1:4483606-4483628 CCCCAAAGGCTGAGTCCAGGGCA No data
Right 900762721 1:4483638-4483660 GGGGAATAGGGTCTAGAATGAGG No data
900762710_900762724 28 Left 900762710 1:4483606-4483628 CCCCAAAGGCTGAGTCCAGGGCA No data
Right 900762724 1:4483657-4483679 GAGGCCTAGGTCCTGCATTTGGG No data
900762710_900762720 -3 Left 900762710 1:4483606-4483628 CCCCAAAGGCTGAGTCCAGGGCA No data
Right 900762720 1:4483626-4483648 GCACTTCAGGAGGGGGAATAGGG No data
900762710_900762722 15 Left 900762710 1:4483606-4483628 CCCCAAAGGCTGAGTCCAGGGCA No data
Right 900762722 1:4483644-4483666 TAGGGTCTAGAATGAGGCCTAGG No data
900762710_900762726 30 Left 900762710 1:4483606-4483628 CCCCAAAGGCTGAGTCCAGGGCA No data
Right 900762726 1:4483659-4483681 GGCCTAGGTCCTGCATTTGGGGG No data
900762710_900762719 -4 Left 900762710 1:4483606-4483628 CCCCAAAGGCTGAGTCCAGGGCA No data
Right 900762719 1:4483625-4483647 GGCACTTCAGGAGGGGGAATAGG No data
900762710_900762723 27 Left 900762710 1:4483606-4483628 CCCCAAAGGCTGAGTCCAGGGCA No data
Right 900762723 1:4483656-4483678 TGAGGCCTAGGTCCTGCATTTGG No data
900762710_900762717 -10 Left 900762710 1:4483606-4483628 CCCCAAAGGCTGAGTCCAGGGCA No data
Right 900762717 1:4483619-4483641 GTCCAGGGCACTTCAGGAGGGGG No data
900762710_900762725 29 Left 900762710 1:4483606-4483628 CCCCAAAGGCTGAGTCCAGGGCA No data
Right 900762725 1:4483658-4483680 AGGCCTAGGTCCTGCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900762710 Original CRISPR TGCCCTGGACTCAGCCTTTG GGG (reversed) Intergenic
No off target data available for this crispr