ID: 900762715

View in Genome Browser
Species Human (GRCh38)
Location 1:4483617-4483639
Sequence GAGTCCAGGGCACTTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900762706_900762715 21 Left 900762706 1:4483573-4483595 CCGGGGGGCTGGAGGTGTGTTGT No data
Right 900762715 1:4483617-4483639 GAGTCCAGGGCACTTCAGGAGGG No data
900762705_900762715 22 Left 900762705 1:4483572-4483594 CCCGGGGGGCTGGAGGTGTGTTG No data
Right 900762715 1:4483617-4483639 GAGTCCAGGGCACTTCAGGAGGG No data
900762704_900762715 27 Left 900762704 1:4483567-4483589 CCAGTCCCGGGGGGCTGGAGGTG No data
Right 900762715 1:4483617-4483639 GAGTCCAGGGCACTTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900762715 Original CRISPR GAGTCCAGGGCACTTCAGGA GGG Intergenic
No off target data available for this crispr