ID: 900766626 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:4510166-4510188 |
| Sequence | CTGAAAATACAGAGGAATTT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900766623_900766626 | 25 | Left | 900766623 | 1:4510118-4510140 | CCAGGGAGCACAGGTTTGGTGCT | No data | ||
| Right | 900766626 | 1:4510166-4510188 | CTGAAAATACAGAGGAATTTAGG | No data | ||||
| 900766621_900766626 | 29 | Left | 900766621 | 1:4510114-4510136 | CCTTCCAGGGAGCACAGGTTTGG | No data | ||
| Right | 900766626 | 1:4510166-4510188 | CTGAAAATACAGAGGAATTTAGG | No data | ||||
| 900766624_900766626 | -6 | Left | 900766624 | 1:4510149-4510171 | CCATGAAATGACACTAACTGAAA | No data | ||
| Right | 900766626 | 1:4510166-4510188 | CTGAAAATACAGAGGAATTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900766626 | Original CRISPR | CTGAAAATACAGAGGAATTT AGG | Intergenic | ||
| No off target data available for this crispr | |||||