ID: 900766626

View in Genome Browser
Species Human (GRCh38)
Location 1:4510166-4510188
Sequence CTGAAAATACAGAGGAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900766623_900766626 25 Left 900766623 1:4510118-4510140 CCAGGGAGCACAGGTTTGGTGCT No data
Right 900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG No data
900766621_900766626 29 Left 900766621 1:4510114-4510136 CCTTCCAGGGAGCACAGGTTTGG No data
Right 900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG No data
900766624_900766626 -6 Left 900766624 1:4510149-4510171 CCATGAAATGACACTAACTGAAA No data
Right 900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900766626 Original CRISPR CTGAAAATACAGAGGAATTT AGG Intergenic
No off target data available for this crispr