ID: 900773653

View in Genome Browser
Species Human (GRCh38)
Location 1:4565327-4565349
Sequence CCAATGGAAGGTCACACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900773653_900773659 4 Left 900773653 1:4565327-4565349 CCAACTGTGTGACCTTCCATTGG No data
Right 900773659 1:4565354-4565376 AACTGCATAGACATGGAATGTGG No data
900773653_900773657 -3 Left 900773653 1:4565327-4565349 CCAACTGTGTGACCTTCCATTGG No data
Right 900773657 1:4565347-4565369 TGGCCTCAACTGCATAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900773653 Original CRISPR CCAATGGAAGGTCACACAGT TGG (reversed) Intergenic
No off target data available for this crispr