ID: 900778146

View in Genome Browser
Species Human (GRCh38)
Location 1:4600039-4600061
Sequence AGCTTCCGCCTCTGCAGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900778135_900778146 26 Left 900778135 1:4599990-4600012 CCCTAACAGCCTGTGGGTGCAGG No data
Right 900778146 1:4600039-4600061 AGCTTCCGCCTCTGCAGGGTCGG No data
900778139_900778146 17 Left 900778139 1:4599999-4600021 CCTGTGGGTGCAGGCTTGGTGCT No data
Right 900778146 1:4600039-4600061 AGCTTCCGCCTCTGCAGGGTCGG No data
900778137_900778146 25 Left 900778137 1:4599991-4600013 CCTAACAGCCTGTGGGTGCAGGC No data
Right 900778146 1:4600039-4600061 AGCTTCCGCCTCTGCAGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900778146 Original CRISPR AGCTTCCGCCTCTGCAGGGT CGG Intergenic
No off target data available for this crispr