ID: 900781190

View in Genome Browser
Species Human (GRCh38)
Location 1:4618050-4618072
Sequence TCCTTATCTTGAGTGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900781186_900781190 2 Left 900781186 1:4618025-4618047 CCACTTCTTAGAGTGATGGGAAC No data
Right 900781190 1:4618050-4618072 TCCTTATCTTGAGTGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900781190 Original CRISPR TCCTTATCTTGAGTGGGTGC TGG Intergenic
No off target data available for this crispr