ID: 900782556

View in Genome Browser
Species Human (GRCh38)
Location 1:4627527-4627549
Sequence CCTGCAGAGGCTGCCCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900782556_900782563 28 Left 900782556 1:4627527-4627549 CCAGCGGGGGCAGCCTCTGCAGG No data
Right 900782563 1:4627578-4627600 AGAGCCAGTGTGGACAACATCGG No data
900782556_900782562 18 Left 900782556 1:4627527-4627549 CCAGCGGGGGCAGCCTCTGCAGG No data
Right 900782562 1:4627568-4627590 CTACAGAGCGAGAGCCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900782556 Original CRISPR CCTGCAGAGGCTGCCCCCGC TGG (reversed) Intergenic
No off target data available for this crispr