ID: 900783399

View in Genome Browser
Species Human (GRCh38)
Location 1:4632267-4632289
Sequence CCATGTGAGGCTCTGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900783391_900783399 -6 Left 900783391 1:4632250-4632272 CCCAAAAAGGCCCTATGCCATGT No data
Right 900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG No data
900783385_900783399 24 Left 900783385 1:4632220-4632242 CCACACCTCAAGATCCTTACATT No data
Right 900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG No data
900783389_900783399 -2 Left 900783389 1:4632246-4632268 CCCACCCAAAAAGGCCCTATGCC No data
Right 900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG No data
900783390_900783399 -3 Left 900783390 1:4632247-4632269 CCACCCAAAAAGGCCCTATGCCA No data
Right 900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG No data
900783386_900783399 19 Left 900783386 1:4632225-4632247 CCTCAAGATCCTTACATTAATCC No data
Right 900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG No data
900783392_900783399 -7 Left 900783392 1:4632251-4632273 CCAAAAAGGCCCTATGCCATGTG No data
Right 900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG No data
900783387_900783399 10 Left 900783387 1:4632234-4632256 CCTTACATTAATCCCACCCAAAA No data
Right 900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900783399 Original CRISPR CCATGTGAGGCTCTGGGATG AGG Intergenic
No off target data available for this crispr