ID: 900783578

View in Genome Browser
Species Human (GRCh38)
Location 1:4633582-4633604
Sequence CCGGGTGCCCAGTGCGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900783562_900783578 23 Left 900783562 1:4633536-4633558 CCTGCCTGACCTGGAGAATGGTT No data
Right 900783578 1:4633582-4633604 CCGGGTGCCCAGTGCGGCAGAGG No data
900783566_900783578 14 Left 900783566 1:4633545-4633567 CCTGGAGAATGGTTCAGAGGGCA No data
Right 900783578 1:4633582-4633604 CCGGGTGCCCAGTGCGGCAGAGG No data
900783563_900783578 19 Left 900783563 1:4633540-4633562 CCTGACCTGGAGAATGGTTCAGA No data
Right 900783578 1:4633582-4633604 CCGGGTGCCCAGTGCGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900783578 Original CRISPR CCGGGTGCCCAGTGCGGCAG AGG Intergenic
No off target data available for this crispr