ID: 900786220

View in Genome Browser
Species Human (GRCh38)
Location 1:4652597-4652619
Sequence GAACCCCTTGGGCAGCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900786220_900786224 -8 Left 900786220 1:4652597-4652619 CCACAAGGCTGCCCAAGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 900786224 1:4652612-4652634 AGGGGTTCCTGGAGCCGACACGG 0: 1
1: 0
2: 0
3: 8
4: 139
900786220_900786227 2 Left 900786220 1:4652597-4652619 CCACAAGGCTGCCCAAGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 900786227 1:4652622-4652644 GGAGCCGACACGGTCCGGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 24
900786220_900786225 -3 Left 900786220 1:4652597-4652619 CCACAAGGCTGCCCAAGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 900786225 1:4652617-4652639 TTCCTGGAGCCGACACGGTCCGG 0: 1
1: 0
2: 0
3: 1
4: 63
900786220_900786231 23 Left 900786220 1:4652597-4652619 CCACAAGGCTGCCCAAGGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 900786231 1:4652643-4652665 GGAGCCCCTCCCTGCCCTGCTGG 0: 1
1: 0
2: 10
3: 74
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900786220 Original CRISPR GAACCCCTTGGGCAGCCTTG TGG (reversed) Intergenic
900786220 1:4652597-4652619 GAACCCCTTGGGCAGCCTTGTGG - Intergenic
902383793 1:16065138-16065160 GTGCCCCTTGGGCATCCATGTGG - Intronic
902595435 1:17506424-17506446 GGACACCTTGGTCAGCCTTTGGG - Intergenic
906636144 1:47411988-47412010 GAAGCCCTGCGGCAGCCTTCAGG + Intergenic
915274033 1:154775788-154775810 GAACCCTTTGAGCAGCCATTAGG - Intronic
916584590 1:166139552-166139574 GAGCCCATAAGGCAGCCTTGGGG + Intronic
920524871 1:206659188-206659210 AAACCCATTTGGCAGCTTTGGGG - Intronic
924706433 1:246506763-246506785 AAAGCCATTGGGCAGACTTGAGG - Intronic
1065852858 10:29805301-29805323 GATGGCCTTGGGCAGCCCTGTGG + Intergenic
1069417921 10:68217988-68218010 GAACCTCTTGGTCATCCATGAGG - Intergenic
1071502502 10:86213714-86213736 GGACCCCAGGGGGAGCCTTGTGG - Intronic
1072739149 10:97899301-97899323 TAACCCATTGGGCAGCCACGTGG + Intronic
1076366131 10:129922069-129922091 GAATCCATTGGGAGGCCTTGAGG + Intronic
1081653228 11:44839590-44839612 GAACCCCTGGGGCAGACAGGGGG - Intronic
1081770812 11:45649717-45649739 GAACCCCTCGGTCAGCCTGGTGG - Exonic
1081967483 11:47178426-47178448 GAACCCCGGTGGCAGCCTTCCGG + Exonic
1083292976 11:61700023-61700045 GCACTGCTGGGGCAGCCTTGGGG - Intronic
1084746308 11:71172039-71172061 TCAACCCTTGGGCAGCCATGGGG - Intronic
1084938025 11:72597534-72597556 GAAGCCCTTGGCCAGGCTGGTGG - Exonic
1090765928 11:129876380-129876402 GAATCCCTTTGGCAGTCTGGTGG - Intronic
1091039490 11:132263203-132263225 GGCCCCCTTGAACAGCCTTGGGG - Intronic
1091688720 12:2581596-2581618 GAACTCCTTGAGCAACCTGGTGG + Exonic
1092674607 12:10901529-10901551 GAACTCCCTGCTCAGCCTTGGGG - Intronic
1095465545 12:42484238-42484260 CACCCCCTTGGCCAGCCTAGCGG + Intronic
1104662649 12:130622245-130622267 GAACCTCCTATGCAGCCTTGTGG - Intronic
1104849956 12:131868131-131868153 GAACCCCATGGGCTGCCTCGAGG - Intergenic
1105279033 13:18952611-18952633 GAGCCCAGTGGGCAGCCTTGGGG + Intergenic
1106103409 13:26713722-26713744 GAACCCCTGGGCCATCCTAGAGG + Intergenic
1106559065 13:30833252-30833274 GACCCTCTGGGCCAGCCTTGGGG + Intergenic
1112459948 13:99595018-99595040 GAGCCCCTGGGGCATCTTTGTGG - Intergenic
1112839872 13:103563050-103563072 CAACCTCTAGGCCAGCCTTGTGG - Intergenic
1118329328 14:64803549-64803571 TAAGGCCCTGGGCAGCCTTGAGG + Intronic
1118472832 14:66090891-66090913 GAACCTCTTTGCCAGCCTTCTGG - Intergenic
1118569937 14:67184349-67184371 AAAACGCTTTGGCAGCCTTGAGG + Intergenic
1118674133 14:68164556-68164578 GATCCCCTTGGTGAGCATTGTGG + Intronic
1118863749 14:69685903-69685925 GAACCTCTTGAGCAGTCGTGAGG + Intronic
1121283143 14:92713794-92713816 CAGCCCTTGGGGCAGCCTTGTGG - Intronic
1122505191 14:102227494-102227516 GAGACCCTGGTGCAGCCTTGAGG - Intronic
1124135852 15:27035790-27035812 AAGCCCCTTGGGCAGCACTGTGG + Intronic
1124704674 15:31953925-31953947 GATCTCCTAAGGCAGCCTTGAGG - Intergenic
1125231481 15:37462068-37462090 CAGCCCCTGAGGCAGCCTTGAGG - Intergenic
1127256735 15:57299440-57299462 GAAGCCCTGGAGAAGCCTTGGGG - Intergenic
1143825993 17:9607857-9607879 AATCCCCTTGGTCAGCCTGGGGG + Intronic
1152828392 17:82481766-82481788 GAACCACTTGGGCAGTGTGGTGG + Intronic
1153717212 18:7862066-7862088 GTACACCTTTGGCAGCCTGGTGG + Intronic
1160505310 18:79423453-79423475 GATCCACTTGCCCAGCCTTGGGG + Intronic
1164713114 19:30373261-30373283 GAATCCCTTGTCCAGCCTGGAGG + Intronic
1167440104 19:49503404-49503426 GGGCCCCTTGGGCAGGCTTAAGG + Intergenic
1168136636 19:54356288-54356310 GAACCTCAGGGGCAGCCTGGCGG + Intronic
925075837 2:1014926-1014948 GAACCCGAGGGGCAGCCTTGAGG + Intronic
925184868 2:1840268-1840290 CACCCCCTTGGGCAGCCCAGCGG + Intronic
925314410 2:2910019-2910041 GAACCACGGCGGCAGCCTTGGGG + Intergenic
925417596 2:3681907-3681929 GAACCCTTTGAGAAGCCTTTGGG - Intronic
932417716 2:71583877-71583899 GGACCCCTGGGGGAGCCCTGTGG + Intronic
936506895 2:113115335-113115357 GAATTCCTTTGGGAGCCTTGGGG + Intronic
944639584 2:201709999-201710021 GCACCCCCTGGGCAGGCTTGTGG - Exonic
944901530 2:204221504-204221526 GAACCCCATGGACAGTCTTCAGG - Intergenic
945933539 2:215880597-215880619 CAACCCCATGGGCAGCTCTGTGG + Intergenic
946401976 2:219472986-219473008 GACCCCCTTACGCAGCCCTGTGG - Exonic
946404185 2:219483913-219483935 GATCCCCGTGGCCAGGCTTGGGG + Exonic
946979192 2:225188406-225188428 GAAAACCTTGGGCAGAGTTGAGG - Intergenic
947521626 2:230850131-230850153 GAGCCCCCTGGCCAGGCTTGGGG + Intergenic
947861402 2:233361039-233361061 GCAGCCCTAGGGCAGCCCTGGGG + Intronic
949076709 2:242063928-242063950 GCACCTCCTGGGCAGCCCTGAGG + Intergenic
1170015807 20:11780573-11780595 TAACCACTTGGGCAGCTGTGGGG + Intergenic
1171191712 20:23163692-23163714 AAACCCCTTCTGCAGCCTGGGGG + Intergenic
1172227497 20:33314841-33314863 CAGCCCCTTGGCCAGGCTTGCGG - Intergenic
1172787415 20:37478368-37478390 GAATTCCCTGAGCAGCCTTGTGG + Intergenic
1173475361 20:43355326-43355348 CACCTCCTTGGGCAGCCATGTGG - Intergenic
1174301335 20:49584756-49584778 GATTCCCTTGGGCAGCAGTGGGG + Intergenic
1175718118 20:61269031-61269053 GAACCCCATGGAAAGCCCTGTGG + Intronic
1175922054 20:62454777-62454799 GAACCCCAGGGGCGGCCGTGAGG - Intergenic
1180009953 21:45042950-45042972 GCTGCCCTTGGGCAGCCTCGGGG - Intergenic
1180766679 22:18349431-18349453 GAAGCCCTTGGTCACCCTGGGGG + Intergenic
1180812350 22:18770268-18770290 GAAGCCCTTGGTCACCCTGGGGG - Intergenic
1181198509 22:21204515-21204537 GAAGCCCTTGGTCACCCTGGGGG - Intergenic
1181276987 22:21693620-21693642 GGGTCCCCTGGGCAGCCTTGGGG + Intronic
1181401229 22:22651285-22651307 GAAGCCCTTGGTCACCCTGGGGG + Intergenic
1181703194 22:24632365-24632387 GAAGCCCTTGGTCACCCTGGGGG + Intergenic
1181894176 22:26092598-26092620 AAACCCCTTGGTCATCCTTCAGG + Intergenic
1183210840 22:36450133-36450155 GAACCAACTGGGCAGCCATGGGG + Intergenic
1183846264 22:40543289-40543311 GAACCTCTTGTGCAACATTGTGG + Intronic
1184295936 22:43525588-43525610 GAACCTGTTCAGCAGCCTTGAGG - Intergenic
1184834170 22:47011204-47011226 TACCTACTTGGGCAGCCTTGGGG + Intronic
1185371522 22:50463059-50463081 GAGCCTCTGAGGCAGCCTTGGGG - Intronic
1185401817 22:50622878-50622900 GAACGACTGGGGCAGCCCTGGGG - Intronic
1203228296 22_KI270731v1_random:90322-90344 GAAGCCCTTGGTCACCCTGGGGG + Intergenic
949221053 3:1634347-1634369 GAACAGCGTGTGCAGCCTTGAGG - Intergenic
953620190 3:44526277-44526299 GGAACCATTGGCCAGCCTTGGGG - Intergenic
955378955 3:58421622-58421644 AAACCCCCTTGACAGCCTTGTGG - Intronic
955840431 3:63106999-63107021 GAACTCCTTAGGTAGCATTGTGG + Intergenic
955920317 3:63948068-63948090 GAATCACTCTGGCAGCCTTGTGG + Intronic
956049329 3:65230723-65230745 GAGCTCCATGGGCAGCTTTGAGG + Intergenic
962437456 3:135380183-135380205 CAACCCCATGGGGAGCTTTGGGG - Intergenic
962852976 3:139321773-139321795 GTACCCTTTGGTAAGCCTTGGGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969697727 4:8744603-8744625 GAACCCCATGCCCAGCCTTCCGG + Intergenic
971198778 4:24493147-24493169 CACCCCCTTCGGCCGCCTTGAGG - Intergenic
972585285 4:40431936-40431958 GGACCACTTGACCAGCCTTGAGG - Intronic
977848216 4:101791093-101791115 GAACCCTCTGGGCTGCCTGGCGG - Intronic
979755906 4:124339318-124339340 GCACTCCTTGGGGAGGCTTGGGG - Intergenic
981403698 4:144342443-144342465 GAAGCCCTGGGGCAGACATGGGG + Intergenic
985669568 5:1200570-1200592 GGACCCCGTGGTCAGCCCTGTGG + Intergenic
986459379 5:7954550-7954572 GAACTCCTAGGGCAGCAATGGGG - Intergenic
1001017747 5:168156906-168156928 GAACGCCTGGGGCAGCCGTTCGG + Intronic
1001571840 5:172735325-172735347 GGACCCCTCTGGCTGCCTTGTGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1006629659 6:35422023-35422045 GAGCCCTTGGGGCAGCCTAGAGG + Intronic
1007167031 6:39835956-39835978 GAATCCCTAGGGCAGGGTTGGGG + Intronic
1007169337 6:39851727-39851749 CAGCCCCTTGGGAAGCCTTTGGG + Intronic
1007276881 6:40680554-40680576 GAACCCCTTGGGCAGCTATAGGG + Intergenic
1007406937 6:41640657-41640679 GAGCCCCTGGGGCAGCGCTGTGG - Intronic
1007749250 6:44062151-44062173 CAGCCTCATGGGCAGCCTTGTGG + Intergenic
1011637300 6:89386169-89386191 GGAGCCCTTGGGGAGCCTTCAGG + Intronic
1017818380 6:158031272-158031294 GAACCCCTAGGGGATCCTTGGGG + Intronic
1018787879 6:167122147-167122169 GAGCCTCGTGGGCAGCCTGGGGG + Intergenic
1018799904 6:167213921-167213943 GAACCTCGTGGGAAGCCTGGAGG + Intergenic
1022332841 7:29396756-29396778 GAGCCCTGGGGGCAGCCTTGCGG - Intronic
1030995711 7:116356263-116356285 GACCCCCTGCGGCAGCCTTTAGG + Intronic
1034183399 7:149156043-149156065 GAATCCCTTTGGCTGCTTTGTGG + Intronic
1034238718 7:149592998-149593020 AAACCCATTGGTCAGCCTTATGG - Intergenic
1034242141 7:149618759-149618781 AAACCCATTGGTCAGCCTTATGG - Intergenic
1035063945 7:156091871-156091893 GACACCCCTGGGCAGCCTTCAGG - Intergenic
1035297381 7:157875090-157875112 GATGCCCTTGGGTAGACTTGTGG + Intronic
1036091220 8:5667837-5667859 GAACATCTTGGGCAGCATTGGGG + Intergenic
1037326585 8:17697543-17697565 GAAACACTTGGCCAGCCCTGGGG - Intronic
1040304016 8:46202778-46202800 GCACTCCTGGGGCAGCCCTGGGG - Intergenic
1040326190 8:46342792-46342814 GCTCGCCTTGGGCAGCCCTGGGG - Intergenic
1048375915 8:133822285-133822307 GCATCCCATAGGCAGCCTTGAGG + Intergenic
1049806797 8:144544717-144544739 GACCCCATGGGGCAGCTTTGGGG + Intronic
1049836389 8:144738249-144738271 GAACCCCATGGGCAACCAGGTGG - Intronic
1050585087 9:7102419-7102441 GAATCACTCGGGCAGCTTTGGGG + Intergenic
1055552284 9:77442626-77442648 GATTCCATAGGGCAGCCTTGAGG + Intronic
1060115277 9:120935472-120935494 GAACTGCTTGGGGAGCCCTGGGG + Intergenic
1060210103 9:121704940-121704962 GAGCCCCATGGGCACCTTTGGGG + Intronic
1060723593 9:125993750-125993772 AGAGCCCTTGGGCAGCCCTGGGG - Intergenic
1061738375 9:132679388-132679410 AAACCCCTTCAGAAGCCTTGTGG + Exonic
1190152301 X:47958463-47958485 CAACCCCCTGGGCAGACTGGCGG - Intronic
1193392550 X:80946003-80946025 GACCACCTTGTGGAGCCTTGGGG - Intergenic
1194960273 X:100227195-100227217 AAACTCCTTGGCCAGCCATGCGG - Intergenic
1197064333 X:122220760-122220782 GGGCCCCTGAGGCAGCCTTGGGG - Intergenic
1200122329 X:153797107-153797129 GCACCCCTTGGGCAGCCCACTGG + Intronic