ID: 900787028

View in Genome Browser
Species Human (GRCh38)
Location 1:4655616-4655638
Sequence CTGGAGCAGCACCGCGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900787020_900787028 2 Left 900787020 1:4655591-4655613 CCGGAAAGGGGCGCCCGCCCGGA 0: 1
1: 0
2: 0
3: 5
4: 62
Right 900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG 0: 1
1: 0
2: 2
3: 25
4: 214
900787018_900787028 9 Left 900787018 1:4655584-4655606 CCGGTAGCCGGAAAGGGGCGCCC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG 0: 1
1: 0
2: 2
3: 25
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900787028 Original CRISPR CTGGAGCAGCACCGCGGCCC TGG Intronic
900029875 1:363654-363676 CTGAAGCAGCTCTGAGGCCCTGG - Intergenic
900050526 1:592718-592740 CTGAAGCAGCTCTGAGGCCCTGG - Intergenic
900137557 1:1124825-1124847 CTGCAGCAGTGCCGTGGCCCAGG - Intergenic
900234918 1:1583842-1583864 CTGGGGCAGCCCCGGGTCCCAGG - Intergenic
900488268 1:2933707-2933729 CTTGAGCAGGACCGGGGTCCCGG + Intergenic
900490636 1:2947195-2947217 CTGGAGCAGCGGCCAGGCCCTGG - Intergenic
900558793 1:3293318-3293340 CGGGACCAGCACCGCATCCCAGG + Intronic
900655039 1:3752672-3752694 CTGGAGGAGCACCAGGGCCCTGG - Exonic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
901514800 1:9737902-9737924 CGGGAGCAGCATTGCAGCCCAGG - Intronic
902823464 1:18956954-18956976 CTGGTGCAGCTCTGCGGTCCGGG - Intergenic
902873666 1:19328595-19328617 CAGGCGCAGCACCGCCGCCTCGG + Exonic
903183627 1:21617718-21617740 CTGGAGCATGACCTTGGCCCAGG + Intronic
903345907 1:22684262-22684284 CTGGAGCCGCAGCAGGGCCCAGG + Intergenic
904355548 1:29936727-29936749 ATGGAGCTGCACCTGGGCCCAGG - Intergenic
905755892 1:40508846-40508868 CGGGAGCAGCTCCGAGGCCGCGG + Exonic
907417320 1:54323477-54323499 CTGGAGCAACACCTCCTCCCAGG - Intronic
910812534 1:91253146-91253168 CAGGAGCACCTCCTCGGCCCAGG + Intergenic
915247787 1:154568490-154568512 CTGGACCAGCACCCCTCCCCGGG + Intronic
915314893 1:155022940-155022962 CTGTGTCAGCACCGTGGCCCAGG - Intronic
918388645 1:184036569-184036591 CTGGAGCAGGAGCCCGGCACCGG + Intronic
920190469 1:204190589-204190611 CTGCACCAGCACCGCGCCCTGGG + Exonic
921633579 1:217464630-217464652 CTGGAGCAGAACAGAGGCCAAGG + Intronic
1064351459 10:14581277-14581299 CTGGAGAAACACAGAGGCCCTGG + Intronic
1065102025 10:22340776-22340798 CTGGAGCCGCACTGCCGCTCGGG - Intergenic
1065834413 10:29643974-29643996 CTGGAGCAACATCGCGTTCCTGG + Intronic
1067064836 10:43097805-43097827 CTGGAGGAGCCCAGCGGCCCTGG + Intronic
1067568893 10:47357384-47357406 CTGGAGCATCTCCTTGGCCCTGG - Exonic
1067835041 10:49633213-49633235 CTGGAAAAGCACTGGGGCCCGGG - Intronic
1069777061 10:70933385-70933407 GTGGAGCAGCACTGGGGACCAGG + Intergenic
1072433234 10:95392156-95392178 CTGGAGCAGCACCACGGACAGGG + Intronic
1072729366 10:97834997-97835019 CTGGAGCATCACAGAAGCCCAGG - Intergenic
1076217723 10:128710102-128710124 ACGGAGCAGCAGCGCGGCCCGGG - Intergenic
1076466709 10:130687741-130687763 CATGAGCAGCACCGCTGCACTGG - Intergenic
1076749729 10:132536870-132536892 CAGGATCAGCATCGCTGCCCCGG + Intergenic
1076837147 10:133026907-133026929 ATCCAGAAGCACCGCGGCCCAGG + Intergenic
1077038448 11:506811-506833 CAGGCGCAGCCCCGCGCCCCGGG + Intronic
1083176132 11:60951511-60951533 CGGGAGCAGCCCCGCGTGCCCGG - Exonic
1083800134 11:65041735-65041757 CTGCAGCAGCACCGGGTCCGCGG - Exonic
1083822744 11:65182063-65182085 CTGGGGCAGCCCCTCAGCCCAGG - Intronic
1084067051 11:66710698-66710720 CTGCAGCAGCTCCGAGGCCAGGG + Exonic
1084284198 11:68121090-68121112 CGGTAGCGGCAGCGCGGCCCCGG - Exonic
1088211140 11:107457712-107457734 CTGGCGCAACACCTCGGCCCTGG + Exonic
1089153997 11:116386443-116386465 CTGCAGCAGCTCTGCGGCCCTGG + Intergenic
1090780257 11:130001850-130001872 CTGGGGCAGGGCCGCGACCCCGG + Intronic
1091722159 12:2821276-2821298 CTGGTGCAGCACCACGTCTCGGG - Exonic
1092211100 12:6647002-6647024 CAGGAGCAGCACTGCGGAGCGGG + Exonic
1092229439 12:6768454-6768476 CTGGTGCAGAACGGCTGCCCTGG - Intronic
1092522949 12:9292320-9292342 TTGGGGCAGCAGCGCGGCGCAGG - Intergenic
1092544342 12:9439577-9439599 TTGGGGCAGCAGCGCGGCGCAGG + Intergenic
1093095165 12:14963673-14963695 CATGAGCAGCAACACGGCCCTGG + Intergenic
1094508606 12:31082490-31082512 TTGGGGCAGCAGCGCGGCGCAGG - Intronic
1096791390 12:54047344-54047366 CTGCAGCGGCCCCGCGGCGCGGG - Intronic
1097264734 12:57738480-57738502 CTGGAGCAGCACCAAGGTCCCGG - Intronic
1102473609 12:113174721-113174743 GTGGAGCAGCACGGCAGCCTTGG + Exonic
1103728659 12:123011940-123011962 CTGGAGCAGCTCCTGGGCCATGG + Intronic
1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG + Intergenic
1104980239 12:132570335-132570357 CAGGAGCAGCAGCGCCCCCCTGG + Exonic
1105202802 13:18194361-18194383 CTGGATCCGCACAGCGGCCATGG + Intergenic
1108689299 13:52847442-52847464 CGGGCGCAGGACCGCGGACCCGG - Exonic
1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG + Exonic
1112417740 13:99217655-99217677 CTGGAGAAGCACCGCGGGGTGGG - Intronic
1112461467 13:99606814-99606836 CTGTTGCAGCCCCGCGGGCCGGG + Intronic
1113756922 13:112818818-112818840 CTTGAGGAGCCCCCCGGCCCAGG + Intronic
1113869980 13:113553453-113553475 CTGGAGGAGCGCCCCGTCCCGGG - Intronic
1116919935 14:50561188-50561210 CTGGAGCAGCAAGGCGGGCGGGG - Intronic
1118024070 14:61751179-61751201 CGGGCGCAGCACCGCAGTCCCGG + Intergenic
1120211142 14:81635036-81635058 CTGGTGCAGAACCTTGGCCCTGG + Intergenic
1121746097 14:96294455-96294477 CGGCAGCAGCACAGCGGACCTGG + Intronic
1122157009 14:99755877-99755899 CTGGAGCAGGTCCCTGGCCCAGG + Intronic
1122176693 14:99926007-99926029 CTGGGCCAGCACAGCGGTCCTGG - Intronic
1122771818 14:104101059-104101081 CAGGAGCTGCCCCACGGCCCTGG - Intronic
1123414122 15:20082683-20082705 CTGGAGCAGCTCAGGGGCCGAGG + Intergenic
1123523464 15:21089794-21089816 CTGGAGCAGCTCAGGGGCCGAGG + Intergenic
1125674182 15:41493853-41493875 CTGGAGCGGCTCGGCGCCCCCGG - Exonic
1128054790 15:64691514-64691536 CAGGAGCACCACAGAGGCCCTGG + Exonic
1128784260 15:70383264-70383286 GTGGAGCAGCCCCAGGGCCCTGG - Intergenic
1129104560 15:73297141-73297163 CAGAAGCAGCACCAAGGCCCGGG - Intronic
1129221526 15:74134301-74134323 CTGGCGGAGCCCCGCGACCCGGG + Exonic
1129234319 15:74214528-74214550 CTGGTGCTGCCCTGCGGCCCTGG + Intergenic
1129331915 15:74832222-74832244 CAGGAGCAGCTCAGAGGCCCAGG - Intergenic
1130224159 15:82045252-82045274 CCGGAGCCGCGCCGCTGCCCTGG - Intronic
1131977527 15:97961086-97961108 CTCGGCCAGCACCGCGGCCCTGG + Exonic
1132657020 16:1045701-1045723 CTGCACCAGCACCGAAGCCCAGG + Intergenic
1132722830 16:1325422-1325444 CTGCAGCCCCACCGCGGGCCAGG + Exonic
1132758330 16:1496655-1496677 CTGGAGCAGCACCACCACCACGG - Intronic
1132767160 16:1540183-1540205 CTGGAGCAGCACCCAGCCCAAGG + Intronic
1133115753 16:3577151-3577173 CTGGAGCAGCATCGAGGCCCGGG - Exonic
1133772741 16:8877113-8877135 GTGGGGCAGCACAGGGGCCCAGG - Intergenic
1134134109 16:11668487-11668509 CCGCAGCAGCCCCGCGGGCCCGG - Exonic
1137267988 16:46884399-46884421 CTGGAGCAGCTACCCGGCCCCGG - Exonic
1139972624 16:70785732-70785754 GTGGGGCAGCACAGCGCCCCGGG + Exonic
1140041609 16:71412066-71412088 GGGGAGCAGCACCACAGCCCAGG + Intergenic
1140528987 16:75648058-75648080 CTGGGCCAGCAGCACGGCCCCGG - Exonic
1141433129 16:83981156-83981178 CTGAAGCAGCACTGGAGCCCTGG - Intronic
1142411564 16:89919581-89919603 CTGCTGCAGCACCGCAGCCCGGG - Exonic
1142793871 17:2291642-2291664 CTGGAGGATCACTTCGGCCCAGG + Intronic
1143405490 17:6674801-6674823 CTGGCTCAGCCCCGAGGCCCAGG - Intergenic
1144513108 17:15894508-15894530 CTGGATCAGCACAGCCTCCCTGG - Intergenic
1145847024 17:28048959-28048981 CTGGAGTAGCACAGAGGCACAGG - Intronic
1146006946 17:29166393-29166415 CTGGTGCAGCATCCTGGCCCAGG - Exonic
1147723784 17:42554280-42554302 CGCGAGCAGCACCGCTGCGCTGG - Intronic
1147726687 17:42569944-42569966 CTGCTGCAGCACCTCAGCCCTGG + Intronic
1150236997 17:63601200-63601222 CCGGAGCGGCACCGCAGCCCCGG - Exonic
1152280685 17:79383370-79383392 CTGGTGCACCGCCGCGGCCGTGG - Intronic
1152588500 17:81199676-81199698 ACTGAGCAGCACCGTGGCCCAGG - Intronic
1152609797 17:81309931-81309953 TGGGAGCAGCAAAGCGGCCCAGG - Intergenic
1152949882 17:83222906-83222928 CTGAAGCAGCTCTGAGGCCCTGG + Intergenic
1156484455 18:37456097-37456119 CTGAAGCAGGACCGAGGCTCTGG - Intronic
1157867223 18:51197293-51197315 CAGCGGCAGCTCCGCGGCCCTGG - Exonic
1159908315 18:74118990-74119012 CTGGAACAGCACAGTGGCCTAGG + Intronic
1160691864 19:463992-464014 CTGGAGGAGACCCCCGGCCCTGG - Exonic
1160773407 19:843804-843826 CTGGGGCTGCACCGCGGCCTCGG + Intronic
1161070002 19:2255317-2255339 CTGGAGCAGCAGCAGGTCCCAGG + Exonic
1161072968 19:2271422-2271444 CAGGAGCACCACCGAGGCCCCGG - Exonic
1162965005 19:14151394-14151416 GGGGAGCAGCAGCGCGGCCAAGG - Exonic
1165255975 19:34577501-34577523 CCGGGGCTGCAGCGCGGCCCGGG + Intergenic
1165430268 19:35768033-35768055 CTGCAGCAGCAGGGCGGCCTGGG - Exonic
1165454023 19:35900480-35900502 CTGGCGCAGCGCCGAGGCCGCGG - Exonic
925292460 2:2756709-2756731 CTAGGGCAGCACTGAGGCCCCGG + Intergenic
927197846 2:20560301-20560323 CTGGGGCAGCACCCAGGCCTGGG + Intergenic
927697276 2:25246953-25246975 CTTGAGCAGAACGGAGGCCCAGG - Intronic
927713500 2:25339895-25339917 CTGGAGCAGCACCTGATCCCAGG + Intronic
928166092 2:28973201-28973223 CTGGAGCAGCACCTCCCCCGAGG + Intronic
932112402 2:69013216-69013238 CGGGAGCTGCCCGGCGGCCCCGG + Exonic
933655201 2:84881115-84881137 CCGGAGGCGCCCCGCGGCCCCGG - Exonic
933808182 2:86015176-86015198 CTGGAGCAGCACTGGTGACCAGG + Intergenic
934614614 2:95763364-95763386 CTGGAGCAGCTGCGTAGCCCAGG + Intergenic
935754939 2:106269820-106269842 GTGGAGCAGCACCGTCGGCCAGG + Intergenic
936047047 2:109196266-109196288 CTGGAGCAGCCCAGGGGCCCAGG - Intronic
936047220 2:109197155-109197177 CTGCTGCAGCCCTGCGGCCCAGG + Intronic
936153567 2:110034656-110034678 CTGCAGCAGCCCCTGGGCCCAGG + Intergenic
936191114 2:110336759-110336781 CTGCAGCAGCCCCTGGGCCCAGG - Intergenic
941890829 2:170579694-170579716 CTGGAGCACCACCACAGCCTGGG + Intronic
945431683 2:209772100-209772122 CAGGAGCAGGACGGCGGCCGCGG + Exonic
946980464 2:225208443-225208465 CTTGAGCACCACCGGAGCCCAGG + Intergenic
947828179 2:233120568-233120590 CTGGAGGAGCATAGCGCCCCTGG - Intronic
948125921 2:235564736-235564758 CTGGACCAGCACCCAGGGCCAGG + Intronic
1172104171 20:32506286-32506308 CTGGAGCAGGACCTGGGGCCAGG - Intronic
1173503827 20:43571862-43571884 CAGGAGCAGCACAGGGGGCCGGG - Intronic
1174151412 20:48488948-48488970 CAGGAGCAGGGCCGGGGCCCAGG + Intergenic
1174393988 20:50234680-50234702 CTGGGGAAGCACCGAGGCTCTGG + Intergenic
1176120093 20:63450410-63450432 CTGGGGCAGCCCCAGGGCCCTGG - Intronic
1176419065 21:6499514-6499536 GTGGAGAAGCCCCTCGGCCCCGG - Intergenic
1176715154 21:10343644-10343666 CTGGATCCGCACAGCGGCCCTGG - Intergenic
1179694558 21:43107836-43107858 GTGGAGAAGCCCCTCGGCCCCGG - Intergenic
1179893679 21:44350215-44350237 CCCGCGCAGCACCGCCGCCCTGG - Intronic
1180190081 21:46158776-46158798 CTGGGGCAGCACCCGGGCCCTGG - Intergenic
1180603191 22:17036294-17036316 CTGGATCCGCACAGCGGCCCTGG + Intergenic
1181668667 22:24415257-24415279 CAGCAGCAGCACCCCAGCCCTGG - Exonic
1183892162 22:40938567-40938589 CTGGAGGATCACCTGGGCCCAGG - Intergenic
1184683959 22:46087687-46087709 CTGGTGGAGCACCGGGGCCTTGG + Intronic
1184710140 22:46244955-46244977 TGGGAGCAGCACTGCAGCCCAGG - Exonic
1184790462 22:46696635-46696657 CTGGAGCAGCACAGAGGGCATGG - Intronic
1185145653 22:49134350-49134372 CTGGAGCAGCCCCTCTTCCCGGG - Intergenic
1185375618 22:50481577-50481599 CTGGAGCGGAGTCGCGGCCCGGG - Exonic
952419030 3:33114626-33114648 CTGGAGGGGCAACGCGGCCCCGG - Intronic
954747065 3:52793390-52793412 CTGGAGGATCACCTGGGCCCAGG - Intergenic
956990087 3:74752271-74752293 CTGCAGCTGCACAGGGGCCCAGG + Intergenic
961739789 3:129026000-129026022 CTGGAGCCGCACCGCGGGAGAGG - Intronic
962264320 3:133934684-133934706 CTGGAGCAGGGCAGTGGCCCAGG + Exonic
962943353 3:140145629-140145651 CTTAAGCAGCACCTCTGCCCAGG + Intronic
963028304 3:140941951-140941973 CTGGAGACGCACAGCGCCCCGGG - Exonic
964634012 3:158841542-158841564 CTGGAGGACCACCAGGGCCCAGG + Intergenic
966735305 3:183182342-183182364 CTGGAGCACCACGGGGGGCCTGG + Intronic
966919802 3:184604141-184604163 CTGCAGCAGCAGCGAGGCCTCGG - Intronic
968552961 4:1233466-1233488 CTGGAGCGGCAGGGCGGCTCCGG - Intronic
968596858 4:1490219-1490241 CTGGAGCTGTTCCGGGGCCCTGG + Intergenic
969872916 4:10116076-10116098 CCGGAGCAGAACCGCGCCCGGGG + Intronic
973613542 4:52658856-52658878 GGGGCGCAGCAGCGCGGCCCCGG + Intronic
973694506 4:53476823-53476845 CTGCAGCAGCCCAGCAGCCCTGG - Exonic
982712199 4:158768922-158768944 CGGGAGGAGCGCGGCGGCCCCGG - Intergenic
983904487 4:173169349-173169371 CTGGACCAACCCCGCGTCCCCGG - Intronic
985377393 4:189355716-189355738 GTGGAGCAGCCCGGCGGACCGGG - Intergenic
985724854 5:1510778-1510800 CAGATGCAGCACCACGGCCCAGG - Intronic
985757337 5:1726776-1726798 CTGGAGAAGCACCGAAGCCAAGG - Intergenic
987270758 5:16306039-16306061 CTGGACCAGCACAGAGGCCCTGG + Intergenic
988159691 5:27503205-27503227 ATGGAGCAGCAGCAGGGCCCTGG + Intergenic
991435950 5:66596979-66597001 CCGGGGCAGCAGCGCGTCCCAGG + Exonic
994353898 5:98774119-98774141 GTTGAGCAGCGCCGCAGCCCCGG + Exonic
998311608 5:141137573-141137595 CAGGAGGAGCAGGGCGGCCCCGG + Exonic
998315078 5:141174971-141174993 CAGGAGGAGCAGGGCGGCCCCGG + Exonic
998319018 5:141211049-141211071 CAGGAGGAGCAGGGCGGCCCCGG + Exonic
1000285127 5:159820073-159820095 CTGCAGCAGCTCCAGGGCCCTGG + Intergenic
1001250152 5:170140875-170140897 CTGGAGCTGCCCCTCTGCCCAGG + Intergenic
1002744114 5:181456718-181456740 CTGAAGCAGCTCTGAGGCCCTGG + Intergenic
1002923371 6:1589720-1589742 CTGGGGCAGCACCTCAGCCTCGG + Intergenic
1003570640 6:7254255-7254277 CTGGATAAGCACCAAGGCCCAGG - Intergenic
1004043953 6:12009173-12009195 CTGGCGCGGCCCCGCGGCCCCGG - Intronic
1007178114 6:39910047-39910069 CGGGAGGAGCACCAGGGCCCAGG + Intronic
1007473365 6:42104685-42104707 GGGGAGCCGCACCGAGGCCCAGG - Exonic
1007533538 6:42564255-42564277 CTGCAGCCTCACCTCGGCCCCGG - Exonic
1013233311 6:108175737-108175759 CTGGAGCTGCCACCCGGCCCGGG - Intronic
1014782805 6:125584258-125584280 CTGGAGCAGGACCACATCCCAGG + Intergenic
1015366220 6:132401034-132401056 CTGGCGCAGCCCCGCGCCCCCGG - Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017954937 6:159169643-159169665 CAAGAGCAGCAGCGCCGCCCAGG - Exonic
1017989105 6:159470887-159470909 CTTGAGCAGCACCACCGCCGTGG + Intergenic
1018068036 6:160137288-160137310 CGGGAGCAGCTCCGCTACCCAGG + Intronic
1019248973 6:170729947-170729969 CTGAAGCAGCTCTGAGGCCCTGG + Intergenic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1020001173 7:4756825-4756847 CGGGAGCAGCACCGAGGCACAGG - Intronic
1020011599 7:4808609-4808631 AAGAAGCAGCCCCGCGGCCCTGG + Intronic
1020210468 7:6154540-6154562 CCGGAGCACCACCCCGGCCACGG + Exonic
1025155599 7:56603352-56603374 CTGCTGCAGCTCCGCGGGCCCGG - Intergenic
1025713309 7:63931301-63931323 CCGGGCCAGCACCGCGGCCTCGG + Intergenic
1026665289 7:72336269-72336291 TCGGAGCCGCACCGCAGCCCAGG - Intronic
1029640580 7:101816871-101816893 CCGGAGCGGCGGCGCGGCCCGGG - Intronic
1034534188 7:151716796-151716818 CTGGAGCAGCTGCGTGGCTCAGG - Intronic
1035388518 7:158490079-158490101 CGGGAGCAGCAGCGGGGCCGGGG + Intronic
1035499073 8:77388-77410 CTGAAGCAGCTCTGAGGCCCTGG - Intronic
1038425207 8:27460250-27460272 CAGGAGCAGCAGCTCGGCCTGGG + Exonic
1039471687 8:37817274-37817296 CTGGAGTAGCAGGGCGACCCGGG + Intronic
1039551344 8:38445306-38445328 CTGGAGAAGCACCCCAGGCCAGG - Intronic
1039581174 8:38667934-38667956 CTGGAGCAGCCCATCAGCCCTGG - Intergenic
1040981849 8:53252251-53252273 CTGGAGCACCACTGAGGCCCGGG - Intergenic
1048583971 8:135755713-135755735 CTGGAGAAGCAGCACAGCCCTGG - Intergenic
1049388057 8:142354201-142354223 CTGCACCAGCTGCGCGGCCCTGG + Intronic
1049414010 8:142487248-142487270 CTGGAGCAGCACCCTGGAGCAGG - Intronic
1049593827 8:143474442-143474464 TGGGAGCAGCACGGGGGCCCTGG - Intronic
1049596487 8:143486342-143486364 CTGGGGCCGCACCGAGGCTCTGG + Intronic
1049654198 8:143790639-143790661 CAGATGCAGCACCGCGCCCCGGG - Intergenic
1052821076 9:33138239-33138261 GTGGAGCTGGACCGGGGCCCAGG - Intronic
1056351414 9:85752777-85752799 CTGGAGCATCACCGGAGGCCAGG + Intergenic
1056475092 9:86945873-86945895 ATGCAGCAGCGCCGCTGCCCGGG + Exonic
1057718356 9:97513498-97513520 CTGGAGCAGAACAGATGCCCTGG - Intronic
1058710478 9:107674848-107674870 CGGGAGCAGCAGGGAGGCCCTGG - Intergenic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061378113 9:130238078-130238100 CCGCAGCAGCAGCGCAGCCCAGG - Intergenic
1061668659 9:132175407-132175429 CTGGACCAGCCCCACGGCACAGG - Intronic
1061845812 9:133387391-133387413 CTGCAGAAGCACCGGGGCCTGGG + Intronic
1061900682 9:133670620-133670642 CTGGAGCAGCAGCGGGCCGCAGG - Exonic
1061967817 9:134025867-134025889 TCGGAGCAGCAAGGCGGCCCTGG + Intergenic
1062402609 9:136379073-136379095 CGGGAGCACCACCGGGCCCCGGG + Exonic
1062556294 9:137114678-137114700 CAGCAGCAGGACCGGGGCCCAGG + Exonic
1062597842 9:137307089-137307111 CAGTAGAAGCACCGCAGCCCAGG + Exonic
1203609928 Un_KI270748v1:87211-87233 CTGAAGCAGCTCTGAGGCCCTGG + Intergenic
1190533972 X:51407886-51407908 CTGGCGCAGAATCGCGGCCTCGG - Exonic
1190533980 X:51407919-51407941 CTGGCGCAGAATCGCGGCCTCGG - Exonic
1190533987 X:51407952-51407974 CTGGCGCAGAATCGCGGCCTCGG - Exonic
1192142801 X:68659815-68659837 CTGGAGCAGCCCTGCAGGCCAGG + Intronic
1198515857 X:137405970-137405992 CTGGGGCGCCACCGCGGCTCTGG + Intergenic