ID: 900787657

View in Genome Browser
Species Human (GRCh38)
Location 1:4658823-4658845
Sequence AGACAGCCCCACGCCTGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900787646_900787657 30 Left 900787646 1:4658770-4658792 CCTTTTCTTCCATGCATTGGAGA 0: 1
1: 0
2: 0
3: 19
4: 238
Right 900787657 1:4658823-4658845 AGACAGCCCCACGCCTGCCGGGG 0: 1
1: 0
2: 1
3: 19
4: 177
900787650_900787657 21 Left 900787650 1:4658779-4658801 CCATGCATTGGAGAGGGGAGCAG 0: 1
1: 0
2: 0
3: 8
4: 238
Right 900787657 1:4658823-4658845 AGACAGCCCCACGCCTGCCGGGG 0: 1
1: 0
2: 1
3: 19
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900787657 Original CRISPR AGACAGCCCCACGCCTGCCG GGG Intronic