ID: 900790126

View in Genome Browser
Species Human (GRCh38)
Location 1:4674519-4674541
Sequence CTGACCTCTGAACCTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900790126_900790130 1 Left 900790126 1:4674519-4674541 CCTGCTTTAGGTTCAGAGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 900790130 1:4674543-4674565 GCAGAAGCAGAAATACGGAGGGG 0: 1
1: 0
2: 0
3: 26
4: 264
900790126_900790133 18 Left 900790126 1:4674519-4674541 CCTGCTTTAGGTTCAGAGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 900790133 1:4674560-4674582 GAGGGGGCTTTCATATTAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
900790126_900790132 15 Left 900790126 1:4674519-4674541 CCTGCTTTAGGTTCAGAGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 900790132 1:4674557-4674579 ACGGAGGGGGCTTTCATATTAGG 0: 1
1: 0
2: 0
3: 2
4: 51
900790126_900790129 0 Left 900790126 1:4674519-4674541 CCTGCTTTAGGTTCAGAGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 900790129 1:4674542-4674564 TGCAGAAGCAGAAATACGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 249
900790126_900790131 2 Left 900790126 1:4674519-4674541 CCTGCTTTAGGTTCAGAGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 900790131 1:4674544-4674566 CAGAAGCAGAAATACGGAGGGGG 0: 1
1: 0
2: 0
3: 25
4: 316
900790126_900790128 -1 Left 900790126 1:4674519-4674541 CCTGCTTTAGGTTCAGAGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 900790128 1:4674541-4674563 GTGCAGAAGCAGAAATACGGAGG 0: 1
1: 0
2: 0
3: 12
4: 160
900790126_900790127 -4 Left 900790126 1:4674519-4674541 CCTGCTTTAGGTTCAGAGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 900790127 1:4674538-4674560 TCAGTGCAGAAGCAGAAATACGG 0: 1
1: 0
2: 1
3: 25
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900790126 Original CRISPR CTGACCTCTGAACCTAAAGC AGG (reversed) Intronic
900790126 1:4674519-4674541 CTGACCTCTGAACCTAAAGCAGG - Intronic
902260770 1:15223196-15223218 CTGACCTCTCCATCCAAAGCTGG - Intergenic
904099587 1:28013214-28013236 CTGACCTGTGACTCCAAAGCTGG + Exonic
905250282 1:36643935-36643957 CTGCCCTCTGTACCCAGAGCTGG - Intergenic
905603801 1:39278143-39278165 AAGATCTCTGAAACTAAAGCTGG + Intronic
905713267 1:40126103-40126125 CAGACTTCTGTACCCAAAGCTGG + Intergenic
906319675 1:44808329-44808351 TTGAACTCTGAACCTAGGGCAGG + Intergenic
909080247 1:71102183-71102205 TTGACCTCTGAAAATAAAGGAGG + Intergenic
910865331 1:91783102-91783124 GTGACCTTGGATCCTAAAGCTGG + Intronic
912978381 1:114349601-114349623 CTGACCTTGGAATCTAAAGTTGG + Intergenic
915558400 1:156672971-156672993 CTGATCTCTGCATCTACAGCAGG + Exonic
916885855 1:169067290-169067312 CTGATCTCAGAAGCTAAAGACGG + Intergenic
917185625 1:172351853-172351875 CTGACCTCTGGCATTAAAGCTGG - Intronic
920552321 1:206872973-206872995 TTGAACTCTGAATCCAAAGCTGG - Intergenic
921970855 1:221147455-221147477 AAGACCTCTGAAGCTAAAGGTGG - Intergenic
1066371945 10:34824976-34824998 CTGCCCCCTGCAGCTAAAGCTGG + Intergenic
1072039991 10:91597794-91597816 CTGCCCCCTGGACCTACAGCTGG - Intergenic
1073588287 10:104731901-104731923 CTGACTTCTGAGCCCATAGCTGG - Intronic
1074783134 10:116816553-116816575 CTGACTTCCTAACCTTAAGCTGG + Intergenic
1074798400 10:116972970-116972992 CTGGCTTCTGAAACTAAACCAGG + Intronic
1076348819 10:129800772-129800794 CTGACCCCTTAACCTCAAGCAGG + Intergenic
1076472254 10:130727437-130727459 CTGATCTCTGAGCCTACAGAGGG + Intergenic
1078982870 11:16558109-16558131 ATGGTCTCTGAAACTAAAGCAGG + Intronic
1088202825 11:107358826-107358848 GGGACCTCTGAACCTGCAGCTGG + Intronic
1089786826 11:120913536-120913558 CTGAACTGTGAACCTAGAGGGGG - Intronic
1096682768 12:53268021-53268043 CTGAGCTCTGAAGATAAAGGAGG + Intergenic
1097143789 12:56925704-56925726 CTGACCTCTGACCGTAGAGCTGG + Intronic
1099931105 12:89076012-89076034 CTGATCACTGAAGCTAAAGCAGG + Intergenic
1101111795 12:101493648-101493670 CTGAGCTCTGGTCCTGAAGCAGG + Intergenic
1101584882 12:106076967-106076989 CTGAACTGTGTACCTAAAACTGG + Intronic
1102902616 12:116650142-116650164 CAGACCTCAGAACCCAAGGCAGG + Intergenic
1103744241 12:123111384-123111406 CTGTCCTCAGCTCCTAAAGCAGG - Intronic
1104872172 12:132007758-132007780 TTGAGCTTTGAACGTAAAGCTGG + Intronic
1110068598 13:71143286-71143308 GTGCCCTCTGAACCTCATGCGGG + Intergenic
1113396801 13:109955506-109955528 CTTACCTATGTATCTAAAGCTGG - Intergenic
1115523051 14:34252338-34252360 CTGACCTCAGCACCTCAGGCTGG + Intronic
1117024786 14:51608326-51608348 CTGACCTCAGATTCTAGAGCTGG - Intronic
1117393109 14:55281511-55281533 ATGACGTCTAAACCTAGAGCAGG - Intronic
1119081649 14:71700192-71700214 TAAACCTCTGAACTTAAAGCTGG - Intronic
1120862881 14:89270590-89270612 CTGGCCTTTGAACCTAAGGTTGG + Intronic
1121542307 14:94737610-94737632 CTGAGCTCTGAGCCTAAAGAGGG + Intergenic
1130137247 15:81191666-81191688 TTGACCACTCAACCTAAACCAGG - Intronic
1133299184 16:4771739-4771761 CTGACCTCTGGAGCTATAGGAGG + Intergenic
1133835731 16:9365846-9365868 CTAACCTCTGTATCTAAATCAGG - Intergenic
1135322585 16:21507240-21507262 CTGACCGCTGCAACTACAGCTGG + Intergenic
1136334062 16:29600377-29600399 CTGACCGCTGCAACTACAGCTGG + Intergenic
1137009376 16:35308343-35308365 CTGTCCTCAGAAGCAAAAGCTGG + Intergenic
1139204013 16:65007842-65007864 CTGACACCTGAACACAAAGCAGG + Intronic
1140063948 16:71594125-71594147 CTGCCCTCTAGACCTAAAGCTGG + Intergenic
1144310007 17:14005009-14005031 CTGGCATCTAAATCTAAAGCTGG + Intergenic
1147317736 17:39628785-39628807 CAGACCTCGGAAGCCAAAGCTGG - Intronic
1150317385 17:64180803-64180825 CTAACCTCTAAAACTAAAGTAGG + Intronic
1150988111 17:70222561-70222583 CTGAGATTTGAACCTAAACCTGG + Intergenic
1152256955 17:79245473-79245495 CTGAACTGTGCACCTAAAGATGG - Intronic
1153782206 18:8504692-8504714 CTGGCCTCTGGACCTTAAGGGGG + Intergenic
1155167514 18:23243378-23243400 GTGAACACTTAACCTAAAGCTGG - Intronic
1156229632 18:35140816-35140838 CTAACCTCTGAACATAAATTTGG + Exonic
1168595839 19:57675862-57675884 CTGACCTCAGTAACTAAAGTGGG + Intronic
926055515 2:9771709-9771731 CTGGCCTCTGAGCCCAGAGCTGG - Intergenic
926425190 2:12733448-12733470 CTGAGCTCTGAATCTACATCTGG - Intronic
926605043 2:14888822-14888844 CTGACATCTGACCTTAAAACTGG - Intergenic
927040740 2:19228134-19228156 CTGACTTCTGTACTTTAAGCTGG - Intergenic
927841743 2:26449433-26449455 CTGCCCTCTGAACCTGCAGCTGG + Intronic
932449104 2:71798445-71798467 CTGACCTGTGGCCCTAGAGCAGG - Intergenic
933057433 2:77689686-77689708 TTTAGCTCTGAACCAAAAGCAGG + Intergenic
933199741 2:79435303-79435325 CTGCACTCTGAACATTAAGCAGG - Intronic
933927573 2:87110876-87110898 TTTAGCTCTGAACCAAAAGCAGG + Intergenic
935376823 2:102408651-102408673 CTGACCTCCAACCATAAAGCGGG - Intergenic
936045791 2:109186834-109186856 CTGAACTCTGACCCCATAGCTGG - Intronic
937138919 2:119581006-119581028 CTCACCTCTGCACCACAAGCTGG - Intronic
942036706 2:172016977-172016999 CTGACCTCTCTACCCAAAGGAGG + Intronic
948007458 2:234622045-234622067 CCGACCTCTGACCCTGAGGCAGG + Intergenic
948202880 2:236142432-236142454 ATGAGCTTTGAACCTAAAGAAGG - Intergenic
948996831 2:241585006-241585028 CTGACCTCGGAAGCTAAGGAGGG + Intronic
1169136316 20:3199960-3199982 CTGACCTCTGACCCTTGACCAGG - Intronic
1169197261 20:3689957-3689979 CTCACCTCTGACCCCAAAGTAGG + Exonic
1170711805 20:18797981-18798003 GTGGCCTCTGAACATAAGGCTGG - Intergenic
1174385679 20:50187447-50187469 CTGCCCTCAGAACCTAGAGCCGG - Intergenic
1179444919 21:41424469-41424491 CTGACCCCAGGACCTAAAGCTGG + Intronic
1179728253 21:43353011-43353033 CTTACCTCTGCAACTCAAGCTGG + Intergenic
1179920651 21:44505431-44505453 CTGATCTGTGCACCTAAAGATGG - Intronic
1180844523 22:18973895-18973917 CTGACCTCTGATCCCCAGGCTGG + Intergenic
1181056950 22:20264816-20264838 CTGACCTCTGACCCCCAGGCTGG - Intronic
950687328 3:14627896-14627918 CTGTCTGCTGAACTTAAAGCAGG - Intergenic
951728184 3:25783159-25783181 CTGCCCTCTGAAGCTCAGGCCGG + Intronic
954256813 3:49412781-49412803 CTGACCTCGGAAGCTAAGCCAGG + Intronic
954420547 3:50416787-50416809 CTCACCTCTGCACCTAGAGGTGG - Intronic
960914550 3:122682250-122682272 CTGACCTCTGAAGTCAAAGTGGG - Intronic
961176531 3:124840132-124840154 CTGACCTCAGAGCCTGAATCTGG - Intronic
962626516 3:137230963-137230985 CTGACCTCAGAGCCTAGAGTGGG + Intergenic
963479000 3:145845271-145845293 GAGACCTCTGAACCCAAAACAGG - Intergenic
963572978 3:147020654-147020676 CTGACCACTGTTCCTCAAGCAGG + Intergenic
967721382 3:192819918-192819940 CCAAGCTCTGAACCTGAAGCAGG + Intronic
968127450 3:196170186-196170208 CTGGCCTCTGAACCTTCTGCTGG - Intergenic
968729551 4:2263085-2263107 GTGACCCCTGACCCTAAGGCTGG + Intergenic
969278400 4:6152520-6152542 CCGACCTCTGATCCTGATGCCGG + Intronic
969422847 4:7107419-7107441 CTGACCTATAAAACGAAAGCTGG - Intergenic
972012417 4:34201257-34201279 CAGACCTCTGAACCTAAACTTGG + Intergenic
972917415 4:43897674-43897696 CTGAGCTGTGAACCTAATGATGG + Intergenic
973006899 4:45019578-45019600 CTGACCACTCTACCTAAAACAGG + Intergenic
975601387 4:76103680-76103702 CTGCCTTCTGAAGATAAAGCTGG + Intronic
975642198 4:76511912-76511934 CTGTCCTCAGAATCTAAAGAAGG + Intronic
979788010 4:124740887-124740909 CTGACCTTCCAATCTAAAGCAGG - Intergenic
982694925 4:158588862-158588884 CTGAAATCTGAACCCAATGCTGG - Intronic
984257101 4:177402093-177402115 CTGTTCACTAAACCTAAAGCAGG + Intergenic
984983379 4:185304028-185304050 TTGACCTCTTAACACAAAGCTGG - Intronic
986584039 5:9295756-9295778 CTGAGCTCTTACCATAAAGCTGG + Intronic
989495583 5:42108004-42108026 ATGAGTTCTCAACCTAAAGCTGG - Intergenic
998606928 5:143645131-143645153 CTGACCTCTGACCCACAACCTGG + Intergenic
1002932255 6:1642838-1642860 CGGATCTCTGCTCCTAAAGCCGG + Intronic
1004710179 6:18162442-18162464 CTGAAATCTGAACATCAAGCAGG - Intronic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013426355 6:110016328-110016350 CTTCCCTCTGAACTCAAAGCAGG - Intergenic
1015090707 6:129354243-129354265 TTAACCTCAGAAGCTAAAGCTGG + Intronic
1015495834 6:133882485-133882507 GTGTACTCAGAACCTAAAGCAGG - Intergenic
1018884411 6:167921071-167921093 CTGAGCACTGAACATACAGCAGG - Intronic
1026153947 7:67811406-67811428 CTGACCTCCGTCCCTAAAGGAGG + Intergenic
1026724412 7:72859422-72859444 CTGAGCTCTGGACCTAAGACAGG - Intergenic
1027953567 7:84851247-84851269 CTGACCTCTGAAATTTCAGCTGG - Intergenic
1030718919 7:112846047-112846069 CTGACCTCTGCCCTTAAAGTAGG - Intronic
1034759653 7:153659341-153659363 CTGTCTTCTGAACCTTTAGCTGG - Intergenic
1035858299 8:3000765-3000787 CTGACAGCTGAAACTAAAGGTGG + Intronic
1037928562 8:22864403-22864425 GTGACCTCTGAACCTAACCCAGG + Intronic
1041978083 8:63822294-63822316 CTGTCCTCTTATTCTAAAGCAGG - Intergenic
1045445643 8:102260356-102260378 CTGAGCTCTGACTCTAAAGTGGG + Intronic
1046748096 8:117897498-117897520 TTGAGCTCTGGATCTAAAGCAGG + Intronic
1049381135 8:142316538-142316560 CTGAACTCTACACTTAAAGCGGG - Intronic
1050187739 9:2992630-2992652 CTGACCTCAACACCCAAAGCTGG - Intergenic
1055768577 9:79691732-79691754 CTGACACCTGAAGCAAAAGCTGG - Intronic
1057426836 9:94957939-94957961 CTGACCTGTGAACTTAAAAATGG - Intronic
1059539160 9:115113533-115113555 TTCACCTCTAACCCTAAAGCTGG - Intronic
1060400840 9:123348775-123348797 CCGGCCACTGAAGCTAAAGCTGG - Intergenic
1060815895 9:126634965-126634987 CTGTCCTCTCACCCTCAAGCCGG + Intronic
1061101770 9:128497683-128497705 TTCACCTCTGAAACTAAGGCTGG - Intronic
1188081853 X:25852858-25852880 CTGGCTTCTGAACATAAGGCAGG - Intergenic
1190228280 X:48562182-48562204 CTGACCTCTGAAGCTAAGCAGGG - Exonic
1192498583 X:71633485-71633507 CTGACCACTGGGCCTAAACCAGG - Intergenic
1200222748 X:154399582-154399604 CTGTCCTCTGAAGGTAAGGCAGG + Exonic