ID: 900790700

View in Genome Browser
Species Human (GRCh38)
Location 1:4678209-4678231
Sequence TGAAGCAGTTAGAGTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900790695_900790700 29 Left 900790695 1:4678157-4678179 CCTGAAATTCATAGCATTCCTTT 0: 1
1: 0
2: 3
3: 31
4: 303
Right 900790700 1:4678209-4678231 TGAAGCAGTTAGAGTGGTGTTGG 0: 1
1: 0
2: 1
3: 48
4: 240
900790698_900790700 11 Left 900790698 1:4678175-4678197 CCTTTGGGTGCAGTTGAAGAAGA 0: 1
1: 0
2: 0
3: 4
4: 178
Right 900790700 1:4678209-4678231 TGAAGCAGTTAGAGTGGTGTTGG 0: 1
1: 0
2: 1
3: 48
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900790700 Original CRISPR TGAAGCAGTTAGAGTGGTGT TGG Intronic
900790700 1:4678209-4678231 TGAAGCAGTTAGAGTGGTGTTGG + Intronic
902721016 1:18304000-18304022 TGAAGCAGGGAGATTGGGGTGGG + Intronic
903087745 1:20878213-20878235 TGAAGCAGTAAGTGTGGCTTTGG - Intronic
904283230 1:29436091-29436113 TGGAGCATTAAGAGTGATGTTGG + Intergenic
906951460 1:50337427-50337449 TGAAGTAGTTAGAGCTGTTTTGG - Intergenic
907104168 1:51865672-51865694 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
908431903 1:64066655-64066677 TGAAGCAGTGAGAGTGGAGAAGG + Intronic
910470083 1:87543095-87543117 TGAAGTAGTTTGAGTGGGATTGG + Intergenic
914239582 1:145844539-145844561 TGAAGAAGTAAGACTGGTGTTGG + Intergenic
914513711 1:148355613-148355635 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
915135111 1:153726267-153726289 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
915144275 1:153785735-153785757 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
918003336 1:180519031-180519053 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
918126266 1:181586836-181586858 AGGAGCAGTTTGAGTGGAGTAGG + Intronic
918505676 1:185251377-185251399 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
920136676 1:203775063-203775085 GGAAGAAGTTGGAGTGGAGTGGG + Exonic
924308096 1:242712614-242712636 AAAAGCAGTAATAGTGGTGTTGG - Intergenic
924374592 1:243391855-243391877 TGAAGCATTCAGAGTGGGTTTGG + Intronic
1064638933 10:17396088-17396110 TGAAGCAATTAGAGAAGTATTGG - Intronic
1065018317 10:21481780-21481802 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1065912517 10:30321292-30321314 TGAAGCAGTGAGAGTGGAGAAGG + Intronic
1067655431 10:48188171-48188193 TGAAGCTGTGAGATTGCTGTGGG - Intronic
1068813998 10:61289186-61289208 TGAAAATGTTACAGTGGTGTTGG + Intergenic
1069014273 10:63410746-63410768 TGGAACAGTTAGTGTAGTGTGGG - Intronic
1070628821 10:78069885-78069907 TGAAGAAGACAGAGTGCTGTGGG + Intergenic
1074735631 10:116429695-116429717 GAAAGCAGTTAGACTGGTGAAGG + Intronic
1076002143 10:126920871-126920893 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1082051263 11:47772291-47772313 TGAATCAGTTGGAGTGGGGTGGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083203352 11:61132947-61132969 GGAAGCAGGGAGAGTGGAGTAGG + Intronic
1083670261 11:64296101-64296123 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1084521932 11:69668580-69668602 GAAAGCAGGTAGAGAGGTGTTGG - Intronic
1088275896 11:108084977-108084999 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1088581838 11:111324193-111324215 TGAAGCAGTTATCCTGGTGCCGG + Intergenic
1091353695 11:134917790-134917812 TGAAGCACTTAGCATGGTGCCGG + Intergenic
1092362739 12:7850732-7850754 TGAAGCTGTGAGAGTGGAGAAGG + Intronic
1094556592 12:31506318-31506340 TGAAGCAGTGGGAGTGGAGAAGG + Intronic
1095462165 12:42454784-42454806 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1096355821 12:50939942-50939964 TGAAGCAGTGGGAGTGGAGGAGG + Intergenic
1097023404 12:56036316-56036338 TGAAGAAGTTTGAGAGGTGGAGG - Exonic
1100578847 12:95919606-95919628 TGAAGCAGTAAGAGCTATGTCGG - Intronic
1100728448 12:97435870-97435892 TTCAGCAGTTAGAGTGCTGCCGG + Intergenic
1101155899 12:101927438-101927460 TGCAGCAGTGAGAGTGGAGAAGG + Intronic
1101760023 12:107650855-107650877 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1102460213 12:113095238-113095260 TGGAGGAGTTGGAGGGGTGTGGG - Intronic
1102959828 12:117085236-117085258 TGAAGCAGCTGGGGTGGTGGGGG + Intronic
1104728268 12:131091059-131091081 TGGAGCAGTTGGGGTGGTGAAGG - Intronic
1107282465 13:38752536-38752558 TGAAGAGATTAGAGTGGGGTGGG - Intronic
1107449862 13:40498513-40498535 TGAAGGAGTTAACCTGGTGTAGG - Intergenic
1108495573 13:51021192-51021214 AGATGCAGTCAGCGTGGTGTAGG - Intergenic
1108519157 13:51230252-51230274 TGCAGCATTTTGAGTGATGTAGG + Intronic
1108783513 13:53866769-53866791 TGAATCAGTTACATAGGTGTTGG - Intergenic
1109319235 13:60789624-60789646 TGAAGCAGTGGGAGTGGAGCAGG - Intergenic
1109780893 13:67108098-67108120 TGGAGCAGTGAGAGGAGTGTGGG - Intronic
1110401579 13:75097812-75097834 AGAGGGAGTTAGAGTGGTGAGGG - Intergenic
1114062628 14:19033341-19033363 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1114099633 14:19366656-19366678 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1114218873 14:20679475-20679497 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1114968365 14:27994348-27994370 TAAAGAAGCTAGGGTGGTGTTGG - Intergenic
1116280279 14:42898171-42898193 TAATGCTGTTAGTGTGGTGTTGG + Intergenic
1116843098 14:49839416-49839438 TGAAGCAGTGGGAGTGGAGAAGG + Intronic
1120902244 14:89585726-89585748 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1122126791 14:99583081-99583103 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1123494165 15:20808127-20808149 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1123550662 15:21377210-21377232 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1124028264 15:25986927-25986949 TGTATCAGTTAGAGTGGGGCAGG - Intergenic
1125203391 15:37122814-37122836 TGAATCAGTTAGAATGTTTTTGG + Intergenic
1125263853 15:37856794-37856816 AGAAGCAGCTAGAGGGGTGCAGG + Intergenic
1125462885 15:39922797-39922819 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1125690559 15:41592902-41592924 AGAATGAGTTAGAGTGGAGTAGG - Intergenic
1126482217 15:49137777-49137799 TGAAGCAGTGGGAGTGGAGAAGG + Intronic
1127201788 15:56662349-56662371 TGAAGCAGTTGGAGTATTGTTGG - Intronic
1202959003 15_KI270727v1_random:104463-104485 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1133582627 16:7160889-7160911 TGAAGAAGTTAGAGTTGAATTGG - Intronic
1137529526 16:49269400-49269422 TGAGGCACTTACAATGGTGTGGG + Intergenic
1138296734 16:55892258-55892280 TGAAGCAGGGATGGTGGTGTGGG - Intronic
1138605014 16:58083083-58083105 TGAAGCAGTGAGAGTAGAGAAGG + Intergenic
1138667571 16:58584959-58584981 TGAAGAAATTAGAGGGGTGGGGG + Intronic
1139761923 16:69191186-69191208 TGAAGCAGTGAGAGTGGAGAAGG - Intronic
1140321723 16:73958959-73958981 TAAAGCACATAGAGTGGTGTTGG - Intergenic
1141866566 16:86754039-86754061 TGAGGCGGGTAGAGAGGTGTTGG - Intergenic
1141889945 16:86919757-86919779 AGGAGCAGATGGAGTGGTGTCGG + Intergenic
1142114775 16:88350921-88350943 GGAAGCAGTGAGAGTGATTTTGG + Intergenic
1143535579 17:7537110-7537132 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1145060342 17:19729284-19729306 AGAAGCAGTTACAGTGGTGATGG + Intergenic
1145976949 17:28989306-28989328 TAAAGCACTTAGAGTGTTGCTGG - Intronic
1148264547 17:46215085-46215107 TGAAGCAGTGGGAGTGGAGAAGG + Intronic
1148824988 17:50386160-50386182 TGAAGCAGTGGGAGTGGAGAAGG + Intronic
1149036983 17:52146129-52146151 TAAAGCAGTTAGAGAGTTGTAGG - Intronic
1150067329 17:62122384-62122406 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1150300802 17:64045414-64045436 TGAAGCAGTTAGAGAGAGGCGGG - Exonic
1152086577 17:78223197-78223219 GGAAGCAGGTAGAGTGGTGCTGG + Intronic
1153826903 18:8883129-8883151 TGAATAAGTTAGAGTGGAGCAGG + Intergenic
1154451694 18:14482585-14482607 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1155040971 18:22065543-22065565 TGAAGAAGTAAGAGGGGTGGAGG + Intergenic
1156935870 18:42706553-42706575 TGAAGCAGCTACAGTTGTCTGGG + Intergenic
1158367399 18:56753241-56753263 TGAAGCAGTGGGAGTGGAGAGGG + Intronic
1158905532 18:62007721-62007743 TGAAGGAGTTATGGTGGTGATGG + Intergenic
1158931893 18:62330877-62330899 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1159133072 18:64303392-64303414 TAAAGCACTTAGAGTGTTCTTGG - Intergenic
1160570777 18:79816290-79816312 TGCAGCAGCTGTAGTGGTGTGGG + Intergenic
1161826803 19:6572971-6572993 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1162637651 19:11982891-11982913 TGAGACAGAGAGAGTGGTGTAGG + Intergenic
1165585425 19:36911184-36911206 TGAAGCAGGTACAGTCTTGTGGG + Intronic
1166770608 19:45279851-45279873 TGAAGCAGTCAGTGTGGCTTTGG + Intronic
1167892245 19:52549824-52549846 TTACTCAGTGAGAGTGGTGTTGG - Intronic
1167907622 19:52675569-52675591 TTACTCAGTGAGAGTGGTGTTGG + Intronic
925596512 2:5560903-5560925 TGAAGCAGCGAGAGAGGTTTCGG - Intergenic
927663029 2:25008860-25008882 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
928942589 2:36741789-36741811 GGAAGCAGTGAGTGGGGTGTTGG - Intronic
929189775 2:39128841-39128863 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
929511229 2:42567985-42568007 TGACGCAGTTAGGGTGGCCTAGG + Intronic
929797924 2:45074543-45074565 GGAGGCAGGTAGGGTGGTGTGGG + Intergenic
931110621 2:59106867-59106889 AGAAGCCATGAGAGTGGTGTGGG + Intergenic
931677213 2:64709315-64709337 TGAAGCAGTTGGGGTGGTTGGGG - Intronic
931690885 2:64834071-64834093 TGAAGCAGTGAGAGTGGAGCAGG + Intergenic
932268609 2:70389420-70389442 TCAAGAAGATAGAGTGGTGCTGG + Intergenic
933716806 2:85367649-85367671 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
935748970 2:106213654-106213676 TGAAGCAGTTAAAATGATATAGG + Intergenic
936923398 2:117712242-117712264 TGAGGCAATTAGAGAGTTGTGGG + Intergenic
937290784 2:120780554-120780576 TCCAGCAGGCAGAGTGGTGTGGG + Intronic
937408653 2:121653524-121653546 TGAAGCAGTGAGAGGGGAATAGG + Intergenic
937615271 2:123914242-123914264 TAAAGCACTTAGAATGGTGCCGG + Intergenic
937779085 2:125816587-125816609 TGAAGAACTTACACTGGTGTTGG - Intergenic
943672782 2:190681366-190681388 TTAAGCAGTTCCAGTGGGGTGGG + Intronic
944648885 2:201808745-201808767 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
945074632 2:206025660-206025682 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1169470220 20:5878601-5878623 TAAATTAGCTAGAGTGGTGTGGG + Intergenic
1170471310 20:16670656-16670678 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1172370274 20:34384176-34384198 TGAAGCAGTGGGAGTGGAGAAGG + Intronic
1174307108 20:49621064-49621086 TGAAGGGGGTAGAGTGGTGTGGG + Intergenic
1175268411 20:57716593-57716615 GGAAGCAGGTAGAGTGGTCTGGG + Intergenic
1176444450 21:6807635-6807657 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1176822615 21:13672673-13672695 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1180021642 21:45132214-45132236 GGAAGCTGTCAGTGTGGTGTTGG + Intronic
1180481120 22:15755968-15755990 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1182177269 22:28303813-28303835 TGAAGCAGTGAGAGTGGAGAAGG - Intronic
1182583046 22:31326746-31326768 AGAAGGAGTTGGAGTGGGGTTGG + Exonic
1182962379 22:34487971-34487993 TAAAGCACTTAGAATGGTGCTGG + Intergenic
1183292840 22:37013282-37013304 TGAAGCAGTGGGAGTGGAGAAGG - Intronic
1184269632 22:43371799-43371821 GGCAGGAGTTAGAGTGCTGTTGG - Intergenic
1184497175 22:44848728-44848750 GGAGGCAGTTAGGGTAGTGTAGG + Intronic
1185131178 22:49039822-49039844 TGGCACAGTTAGAGTGGCGTGGG + Intergenic
951673959 3:25216051-25216073 TGAAGCAGTCAGAGAGGTGCAGG + Intronic
952199339 3:31110294-31110316 TGAATCAGCTAGACTGGGGTAGG + Intergenic
952630657 3:35461909-35461931 TGAAGCAGACAGAGTAGTGCTGG - Intergenic
952886406 3:38014632-38014654 TGAAACAGTGAGAGTGGAGAAGG - Intronic
954761177 3:52875527-52875549 CTAAGCAGCTAGAATGGTGTGGG - Intronic
954852883 3:53618213-53618235 AGAAGCAGTTGGAGAGGTGAGGG + Intronic
959818724 3:110706096-110706118 TGAAAGAGTTTGAGTAGTGTTGG + Intergenic
962228960 3:133643052-133643074 TGAAGCAGTGGGAGTGGAGAAGG + Intronic
962685250 3:137841597-137841619 TGAAGCAGTGAGGGTGAGGTGGG - Intergenic
965068340 3:163882237-163882259 TGAAACAGTAACAGTGGAGTAGG - Intergenic
965290031 3:166866200-166866222 TGAACCAGGCAGAGTGGTGAGGG - Intergenic
967138807 3:186535408-186535430 GGCAGCAGTTAGAGTGCTGCTGG + Intergenic
967621581 3:191641200-191641222 TGAAGCAGTGAGAGTGGAGAAGG - Intergenic
967621584 3:191641338-191641360 TGAAGCATTGAGAGTGGAGAAGG + Intergenic
968425092 4:517927-517949 GGCAGCAGTTAATGTGGTGTTGG + Intronic
968510523 4:993550-993572 TGTAGGAGTTAGAGCTGTGTGGG + Intronic
969697340 4:8742130-8742152 TGAGGGAGTGAGATTGGTGTGGG - Intergenic
969967190 4:11009257-11009279 TAAAGCACTGAGAGTGGTGTGGG + Intergenic
971185716 4:24374112-24374134 GGAAGCAGTTTGAATGTTGTAGG - Intergenic
972315225 4:37920209-37920231 TGAAGCACTTAGAGTCCGGTGGG + Intronic
972426754 4:38940594-38940616 TGAGGCAGGTTGAGTTGTGTAGG - Intronic
973053083 4:45618839-45618861 TGAAGCAGTTATTGTGGTGATGG + Intergenic
974158707 4:58108967-58108989 GAAAGCAGTTAGAGTGGGATGGG - Intergenic
974543492 4:63269816-63269838 GGAAGTAGGTAGAGAGGTGTGGG - Intergenic
977714112 4:100161841-100161863 TGGAGCACTTGGCGTGGTGTTGG - Intergenic
978630101 4:110734273-110734295 AGTAGAAGTTAGAGTGATGTGGG - Intergenic
978801070 4:112755831-112755853 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
981142423 4:141284039-141284061 TGAGTTAGTTATAGTGGTGTTGG + Intergenic
982237652 4:153266924-153266946 TGAAGCAGTGGGAGTGGAGAAGG + Intronic
982626110 4:157768028-157768050 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
982680221 4:158419411-158419433 TGTAGCAATTTGAGTGGGGTGGG - Intronic
984962487 4:185111232-185111254 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
986162498 5:5242368-5242390 TGAAGCAGATAGACTGGAGAAGG - Intronic
988071916 5:26301856-26301878 TGAAGAAATAATAGTGGTGTGGG + Intergenic
989681344 5:44032744-44032766 CAGAGCAGTTAGAGTGGTGGTGG + Intergenic
990581185 5:57169123-57169145 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
992682877 5:79170249-79170271 TGAAGCAGTGGGAGTGGAGAAGG + Intronic
993311502 5:86338288-86338310 TGTAGCACTGAAAGTGGTGTTGG - Intergenic
994246815 5:97488282-97488304 TGAAGCAGTGAGGGGTGTGTGGG + Intergenic
994771414 5:103986405-103986427 TGGAGCCGTTAGAATGGTCTTGG + Intergenic
997229561 5:132232652-132232674 AGAAGCAGTTTGGGTGGTGTGGG - Intronic
997696193 5:135862940-135862962 TGATGCAATCAGAGTGGTGTTGG + Intronic
998616977 5:143751588-143751610 GGAAGGGGTCAGAGTGGTGTGGG + Intergenic
999216499 5:149940045-149940067 TGAAGCAGTAGGAGTGGAGGGGG + Intronic
999815918 5:155176018-155176040 TGAAGCAGTAAGAGTAGAGGAGG + Intergenic
1000833443 5:166130062-166130084 TGAAGCAGGAATTGTGGTGTAGG + Intergenic
1001522560 5:172405068-172405090 TGAAGCAGTAACACTGGTTTGGG + Intronic
1001558262 5:172650968-172650990 TGAATGAGTTAGAGTGGAGCAGG + Intronic
1001836061 5:174833635-174833657 TGAAGGTGTTAGATTGGTGGGGG + Intergenic
1002048693 5:176556768-176556790 TGAAGCAGTTTGAGTGGAGAAGG - Intronic
1002343668 5:178533386-178533408 TGAAGCAGTTAGAGTAGTCCTGG - Intronic
1002939587 6:1704357-1704379 TGAGGCTGGCAGAGTGGTGTGGG + Intronic
1003814702 6:9825601-9825623 TGAATCAGTGAGTCTGGTGTGGG + Intronic
1005449567 6:25959690-25959712 TGATGCACGTAGTGTGGTGTGGG - Intergenic
1005491006 6:26347007-26347029 TGAAGAACATACAGTGGTGTGGG - Intergenic
1006169928 6:32086903-32086925 TGGAGCAGTTTGAGTGGGCTGGG - Intronic
1006786724 6:36672907-36672929 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1007504226 6:42322620-42322642 TGAACAAGTTATAGAGGTGTGGG + Intronic
1007815493 6:44522293-44522315 CTAAGCAGTTGGTGTGGTGTGGG + Intergenic
1008589499 6:52979174-52979196 TGAAGCAGTGGGAGTGGGGAAGG + Intronic
1009059834 6:58385571-58385593 TGAATGAGTTTGAGAGGTGTAGG + Intergenic
1009231078 6:61061825-61061847 TGAATGAGTTTGAGAGGTGTAGG - Intergenic
1010386849 6:75290049-75290071 CAAAGCAGTTAGAGTGGAGGTGG - Intergenic
1010708704 6:79146090-79146112 TGTAGCATTTAGAGTGGAGACGG + Intergenic
1010930091 6:81791184-81791206 TGAGGCAGTGGGAATGGTGTTGG - Intergenic
1012538361 6:100327582-100327604 GGAAGAAGTTAGAGTGGTGGAGG - Intergenic
1013039615 6:106420770-106420792 TGAAGCAGTAGGAGTGGGGAAGG - Intergenic
1013043005 6:106454892-106454914 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1014431716 6:121378812-121378834 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1014867873 6:126554068-126554090 TGAAGCAGTTAGGAGGCTGTTGG - Intergenic
1015227365 6:130873046-130873068 TGTAGGAGTTGGAGTGGTGAGGG - Intronic
1016540261 6:145156754-145156776 AGAAGAAGCTAGATTGGTGTGGG + Intergenic
1019115889 6:169762046-169762068 TGCAGCAGTTATTGTGATGTTGG + Intronic
1020191636 7:6004298-6004320 TGAAGCAGTTGGAGTGGAGAAGG + Intronic
1020214009 7:6175226-6175248 TGAAGCAGTGGGAGTGGGGAAGG + Intronic
1020653405 7:10902037-10902059 TGAAGCAGTGAGAATGGAGAAGG - Intergenic
1021019975 7:15585700-15585722 GGAAGCATATAGATTGGTGTTGG + Intergenic
1021528790 7:21619473-21619495 TAAAGCACTCAGAGTGGTGTTGG - Intronic
1021719511 7:23491807-23491829 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1024692506 7:51818423-51818445 TGAAGCAGATGGAGTGGGTTGGG + Intergenic
1024961155 7:54978335-54978357 TGAAGCAGTAAGAGTGAGATTGG - Intergenic
1026090631 7:67297668-67297690 TGAAGCAGTTGGAGTGGAGAAGG + Intergenic
1026741776 7:72983375-72983397 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1026745829 7:73011208-73011230 TGAAGCAGTTGGAGTGGAGAAGG - Intergenic
1026749482 7:73039149-73039171 TGAAGCAGTTGGAGTGGAGAAGG - Intergenic
1026753130 7:73067295-73067317 TGAAGCAGTTGGAGTGGAGAAGG - Intergenic
1026756781 7:73095421-73095443 TGAAGCAGTTGGAGTGGAGAAGG - Intergenic
1026801617 7:73403803-73403825 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1027031936 7:74895880-74895902 TGAAGCAGTTGGAGTGGAGAAGG - Intergenic
1027090625 7:75298005-75298027 TGAAGCAGTTGGAGTGGAGAAGG + Intergenic
1027094270 7:75325974-75325996 TGAAGCAGTTGGAGTGGAGAAGG + Intergenic
1027097913 7:75353900-75353922 TGAAGCAGTTGGAGTGGAGAAGG + Intergenic
1027101959 7:75381702-75381724 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1027120227 7:75513040-75513062 TGAAGCAGTTGGAGTGGAGAAGG + Intergenic
1027271673 7:76523669-76523691 TGAAGCAGTTGGAGTGGAGAAGG - Intergenic
1027321434 7:77013647-77013669 TGAAGCAGTTGGAGTGGAGAAGG - Intergenic
1027325068 7:77041711-77041733 TGAAGCAGTTGGAGTGGAGAAGG - Intergenic
1027464409 7:78497396-78497418 AGAAGCAGTTTGAGTAGTGTGGG + Intronic
1028525366 7:91778933-91778955 TGAAACAGCTACAGTGGTGGTGG - Intronic
1029399016 7:100330791-100330813 TGAAGCAGTTGGAGTGGAGAAGG + Intergenic
1029717280 7:102336933-102336955 TGAAGCAGTTGGAGTGGAGAAGG - Intergenic
1031248134 7:119343516-119343538 TGAAGCAAATAGAGTGGGGGAGG + Intergenic
1032150522 7:129425561-129425583 TGAAGCACTGGGATTGGTGTTGG - Intronic
1034159714 7:148983819-148983841 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1034588709 7:152119949-152119971 TGACGCAGTTTCAGTGGTGTAGG + Intronic
1035116664 7:156530357-156530379 TGAAGCAGATTGTGTGGTGGGGG - Intergenic
1035943800 8:3935707-3935729 TGAAGGAGGTAGAGAGATGTGGG - Intronic
1036700579 8:11011164-11011186 TGAAGCAGGGACAGTGATGTAGG - Intronic
1037577015 8:20216062-20216084 TGCAGCAGTTAGACATGTGTTGG - Intronic
1038998213 8:32949731-32949753 TCAATAAGTTAAAGTGGTGTAGG - Intergenic
1040527301 8:48236313-48236335 GGAAGCAGTTAGAGTGGTCTTGG - Intergenic
1041863121 8:62536723-62536745 TGAAGCAGTTAGAGTTCAGATGG + Intronic
1044329210 8:90896782-90896804 CGAATGAGTTAGAGTGGAGTAGG - Intronic
1045541916 8:103094533-103094555 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1046434565 8:114170259-114170281 TGAAGAAATTAGAGTGATTTAGG + Intergenic
1047665766 8:127089459-127089481 AGAAGAGGTTAGAGTGATGTTGG + Intergenic
1048579496 8:135719408-135719430 GGAGGCAGTCAGAGTGGTCTAGG + Intergenic
1049346146 8:142139847-142139869 TGAGGCAGGTAGGGTGGGGTGGG - Intergenic
1049533855 8:143169067-143169089 AGAAGGAGTTAGAGGGGTGCAGG - Intergenic
1051023705 9:12578851-12578873 TGGAGTAGTTAGACTGGTGTAGG - Intergenic
1051820456 9:21160250-21160272 TGAAGCAGTGGGAGTGGAGAGGG + Intergenic
1052045942 9:23794149-23794171 TGAAGCAGCTTGAATGCTGTTGG - Intronic
1057711170 9:97446258-97446280 TGAAGCTGTTAGAGAGCTGAGGG + Intronic
1058567459 9:106301877-106301899 TGAGGCAGTGAGAATGGAGTGGG - Intergenic
1060490623 9:124081494-124081516 TGCAGCAGTTAGGGTGGGGTAGG - Intergenic
1060988211 9:127832650-127832672 TGAAGCAATGAGAGTGGAGAAGG + Intronic
1060988359 9:127833966-127833988 TGAAGCAGTGAGTGTGGAGAAGG + Intronic
1061140742 9:128764717-128764739 TGGAGTAGGTAGAGTGGAGTAGG - Intronic
1203524748 Un_GL000213v1:76892-76914 TGAAGCAGTGGGAGTGGAGAAGG + Intergenic
1186325633 X:8473714-8473736 AGAAGCAGAGAGAGGGGTGTCGG + Intergenic
1188998135 X:36911505-36911527 TGAAGCAATTAGTGTTCTGTTGG + Intergenic
1189012712 X:37062704-37062726 TGAAGAATATAGAGGGGTGTGGG - Intergenic
1189471330 X:41316552-41316574 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1190011172 X:46786294-46786316 GGGAGCTGTTAGAGTGGGGTGGG + Intergenic
1190011177 X:46786314-46786336 GGGAGCTGTTAGAGTGGGGTGGG + Intergenic
1192481601 X:71491081-71491103 TGAAGCAGTGAGAGTGGAGAAGG + Intronic
1192581354 X:72284960-72284982 TGAAGCAGTAAGAGTGGAGAAGG + Intronic
1194492581 X:94569612-94569634 GGAAGCAGTTAGAGCGGTCGTGG - Intergenic
1195573810 X:106426632-106426654 TGAAGCAGTGGGAGTGGAGAAGG - Intergenic
1195728639 X:107942749-107942771 TAAAGCATTTAGAGTGATGTTGG - Intergenic
1195953978 X:110309173-110309195 TGAGGCAGATACAGTGCTGTGGG + Intronic
1195966056 X:110431394-110431416 TGAAGCAATGAGAGTGGGATTGG + Intronic
1196971786 X:121117632-121117654 TGAAGTAGATATAATGGTGTTGG + Intergenic
1197705174 X:129629814-129629836 TGAAGTTGTGAGAGTGGTGTGGG + Intergenic
1198167048 X:134068280-134068302 TGAAGCAGTTGGAGTGGAAAAGG - Intergenic
1198420570 X:136467671-136467693 TGAATCAATTAGTCTGGTGTGGG - Intergenic
1199922561 X:152424531-152424553 TGAAGCATTTCAAGTGGTGGGGG - Intronic