ID: 900791495

View in Genome Browser
Species Human (GRCh38)
Location 1:4683878-4683900
Sequence GCTTAGGGCAGGGGGCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900791486_900791495 28 Left 900791486 1:4683827-4683849 CCAGGGTGGGACTTGCACAGGTG 0: 1
1: 0
2: 0
3: 14
4: 161
Right 900791495 1:4683878-4683900 GCTTAGGGCAGGGGGCACTGAGG 0: 1
1: 0
2: 0
3: 33
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900791495 Original CRISPR GCTTAGGGCAGGGGGCACTG AGG Intronic