ID: 900791495 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:4683878-4683900 |
| Sequence | GCTTAGGGCAGGGGGCACTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 446 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 33, 4: 412} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900791486_900791495 | 28 | Left | 900791486 | 1:4683827-4683849 | CCAGGGTGGGACTTGCACAGGTG | 0: 1 1: 0 2: 0 3: 14 4: 161 |
||
| Right | 900791495 | 1:4683878-4683900 | GCTTAGGGCAGGGGGCACTGAGG | 0: 1 1: 0 2: 0 3: 33 4: 412 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900791495 | Original CRISPR | GCTTAGGGCAGGGGGCACTG AGG | Intronic | ||