ID: 900791640

View in Genome Browser
Species Human (GRCh38)
Location 1:4684661-4684683
Sequence ATGTCTGTCTTGAATGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 212}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900791640_900791643 -3 Left 900791640 1:4684661-4684683 CCTACATCATTCAAGACAGACAT 0: 1
1: 0
2: 0
3: 18
4: 212
Right 900791643 1:4684681-4684703 CATCTATCCATTTCACAGGTGGG 0: 1
1: 0
2: 0
3: 27
4: 201
900791640_900791649 28 Left 900791640 1:4684661-4684683 CCTACATCATTCAAGACAGACAT 0: 1
1: 0
2: 0
3: 18
4: 212
Right 900791649 1:4684712-4684734 GGCACAAAGGTATCACTGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 86
900791640_900791650 29 Left 900791640 1:4684661-4684683 CCTACATCATTCAAGACAGACAT 0: 1
1: 0
2: 0
3: 18
4: 212
Right 900791650 1:4684713-4684735 GCACAAAGGTATCACTGTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 87
900791640_900791646 15 Left 900791640 1:4684661-4684683 CCTACATCATTCAAGACAGACAT 0: 1
1: 0
2: 0
3: 18
4: 212
Right 900791646 1:4684699-4684721 GTGGGAACCCTGAGGCACAAAGG 0: 1
1: 0
2: 2
3: 33
4: 273
900791640_900791645 7 Left 900791640 1:4684661-4684683 CCTACATCATTCAAGACAGACAT 0: 1
1: 0
2: 0
3: 18
4: 212
Right 900791645 1:4684691-4684713 TTTCACAGGTGGGAACCCTGAGG 0: 1
1: 0
2: 19
3: 175
4: 1282
900791640_900791642 -4 Left 900791640 1:4684661-4684683 CCTACATCATTCAAGACAGACAT 0: 1
1: 0
2: 0
3: 18
4: 212
Right 900791642 1:4684680-4684702 ACATCTATCCATTTCACAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 160
900791640_900791641 -7 Left 900791640 1:4684661-4684683 CCTACATCATTCAAGACAGACAT 0: 1
1: 0
2: 0
3: 18
4: 212
Right 900791641 1:4684677-4684699 CAGACATCTATCCATTTCACAGG 0: 1
1: 0
2: 1
3: 19
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900791640 Original CRISPR ATGTCTGTCTTGAATGATGT AGG (reversed) Intronic
900791640 1:4684661-4684683 ATGTCTGTCTTGAATGATGTAGG - Intronic
901269337 1:7939425-7939447 ATGATTATCTTGATTGATGTAGG + Intronic
905259284 1:36706172-36706194 ATTTCTGACTTGAATGATTTGGG - Intergenic
905952205 1:41961315-41961337 TTGTGTCTCTTGATTGATGTGGG - Intronic
907321205 1:53603525-53603547 ATGTCTGCCAGGAAAGATGTAGG + Intronic
910008816 1:82434985-82435007 ATGTATGTGTTGAAAGATGTTGG + Intergenic
910574541 1:88745705-88745727 ATTTCTGTGAAGAATGATGTTGG - Intronic
911315783 1:96355063-96355085 ATGTATTTATTGTATGATGTGGG - Intergenic
913483426 1:119311538-119311560 ATGTCTGACTTCAAGGGTGTGGG - Intergenic
914815879 1:151061842-151061864 ATGTCTTTCTTGAATGTATTTGG + Intronic
914975278 1:152355412-152355434 ATGTCTGTCTAGACCCATGTTGG + Exonic
914975336 1:152355868-152355890 ATGTCTGTCTAGACCCATGTTGG + Exonic
915051341 1:153076940-153076962 ATGTCAGTCTTAAAGGCTGTAGG + Intergenic
917111153 1:171549544-171549566 ATACCTGTTTTGAATGATATAGG - Intronic
917980999 1:180269075-180269097 ATGTTAGTTTTGAATGATGCAGG - Intronic
920292466 1:204933401-204933423 GTGTCTGGCTTGAATGACTTGGG + Intronic
1064594544 10:16930227-16930249 ATGTCAGTCTTGAATAATCTTGG - Intronic
1067270250 10:44785364-44785386 GTGACTGTACTGAATGATGTGGG + Intergenic
1068415985 10:56723460-56723482 ATTTCTATATTGAATAATGTAGG + Intergenic
1069401829 10:68056144-68056166 ATGACTGTATTGTATTATGTTGG - Intronic
1069554523 10:69389133-69389155 ATGCCTGGCTTGAATGCTGCCGG - Intronic
1073085905 10:100888616-100888638 ATGTCTGTCTGGCAGGATGGTGG + Intergenic
1081554757 11:44148281-44148303 GTGTCCATCTTGAGTGATGTTGG - Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1082126177 11:48433631-48433653 TTGTGTGTCTTGGATGAAGTGGG + Intergenic
1082559766 11:54604482-54604504 TTGTATGTCTTGGATGAAGTGGG + Intergenic
1084620579 11:70267725-70267747 AGCTGGGTCTTGAATGATGTGGG - Intergenic
1085715997 11:78873941-78873963 AAGTATGTCTTGAAGGATGGGGG - Intronic
1085808203 11:79656254-79656276 ATGTCTGTCTTGTTTGATGATGG + Intergenic
1087426523 11:97994222-97994244 ATGTCTCTTTTGAATGTTGTTGG + Intergenic
1087799564 11:102488944-102488966 ATGTCAGCATTGACTGATGTGGG - Intronic
1087808468 11:102582509-102582531 ATGACTTTCATGAATGAAGTGGG + Intronic
1090886565 11:130882206-130882228 ATGTCAGTCTTAAATGAGGTGGG - Intronic
1093552265 12:20428011-20428033 ATTACTGACTTGAACGATGTGGG - Intronic
1095278594 12:40322297-40322319 AGCTCTGTTTTGAATCATGTAGG + Exonic
1097051442 12:56225447-56225469 ATCTCTGTCTGGGACGATGTTGG + Exonic
1099445044 12:82742214-82742236 CTGTTTGTCTTGAAGGATTTGGG - Intronic
1099572808 12:84346728-84346750 TTGTCTTTCTTGATTGTTGTTGG + Intergenic
1101462531 12:104911354-104911376 AGGCCTGTCTTGGATGATTTTGG + Intronic
1102679408 12:114680885-114680907 ATGTTTGTCTGAAATGTTGTTGG + Exonic
1104717841 12:131028191-131028213 TTGCTTTTCTTGAATGATGTTGG + Intronic
1106380451 13:29232842-29232864 ATGTCTGTATTAAACGTTGTGGG + Intronic
1106757152 13:32833720-32833742 ATGTCTGTTTTGTCTGATATTGG + Intergenic
1109885442 13:68536249-68536271 ATATATTTTTTGAATGATGTGGG - Intergenic
1110149750 13:72237114-72237136 ATGAGTGTCTTAAATGCTGTTGG - Intergenic
1112492669 13:99881199-99881221 GTGTCTGTGTTGAATGACTTCGG + Intronic
1115052968 14:29087299-29087321 ATTTCTGTGTAAAATGATGTTGG - Intergenic
1115318005 14:32046488-32046510 ATGTTTGACATGAATGATCTTGG - Intergenic
1116387580 14:44350312-44350334 AAATCTGTATTGAAGGATGTAGG + Intergenic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1118155149 14:63232994-63233016 ATGTCTTTATTGAGTGATGGAGG - Intronic
1118418064 14:65565745-65565767 ATTTCTGTAATGAATGATATTGG + Intronic
1118630331 14:67696492-67696514 GTGTCTATCTTGAATTATGGTGG + Intergenic
1118646181 14:67842775-67842797 TTGCCTGTTTAGAATGATGTTGG + Intronic
1119439200 14:74616913-74616935 ATGTCTCACTGGAATAATGTTGG + Intergenic
1120390100 14:83895685-83895707 ATGTTTGTCTTGATTGAAATCGG + Intergenic
1120571363 14:86120644-86120666 ATGTATCTCTTCAATGAGGTAGG + Intergenic
1121593827 14:95143246-95143268 ATGGCTGTCCTAAGTGATGTAGG - Intronic
1122762766 14:104042250-104042272 ATGGCTGTTTTGAATTGTGTAGG + Intronic
1123871480 15:24579062-24579084 AACTCTGTCTTTAATGATGCTGG - Intergenic
1124576552 15:30914058-30914080 ATCTCTGTCTTGGAAGATGTGGG - Exonic
1126308344 15:47287121-47287143 ATGTCTGTCTCTCCTGATGTGGG + Intronic
1127217699 15:56841930-56841952 ATTTATGTCTTTAATTATGTTGG - Intronic
1128663658 15:69522672-69522694 ATGTTTCTCTTGGATTATGTTGG + Intergenic
1130838601 15:87675909-87675931 TTCACTGTCTTGAATGATGTTGG - Intergenic
1131641779 15:94300935-94300957 ATGTGTGTCTGGAAGGGTGTGGG + Intronic
1131784876 15:95901628-95901650 ATCTCTGTCCAGAAGGATGTTGG - Intergenic
1132266391 15:100475297-100475319 ATGTTTGTGTTGAGTGATGGTGG - Intronic
1139034676 16:62929462-62929484 AGGTCTGTCTTATATCATGTTGG + Intergenic
1146576771 17:34001171-34001193 GTGTCTGTATTTGATGATGTAGG + Intronic
1146967351 17:37043983-37044005 ATGTCTGTATTGCATGCTGAGGG - Intronic
1147437292 17:40424844-40424866 ATGCCTGCCTTCAATGAGGTGGG - Intergenic
1148895107 17:50835035-50835057 ATGTGTCTCTGGAATGATTTGGG + Intronic
1149221754 17:54422801-54422823 ATTTCTGTGATGAATGATGGTGG - Intergenic
1150182187 17:63134858-63134880 ATTTCTATCTTGAAAGATGCTGG + Intronic
1151230460 17:72681244-72681266 ATGCCTGTTTTCAGTGATGTTGG + Intronic
1151619122 17:75234441-75234463 AAGTCTGTTTTGAATGCTCTTGG + Intronic
1153734628 18:8052446-8052468 GTTTCTGTATTGAATGTTGTAGG - Intronic
1155612662 18:27684435-27684457 AAATCTGTCTAGATTGATGTGGG - Intergenic
1157579247 18:48763911-48763933 AGGTCTGTCATGAGTGATGCAGG + Intronic
1158258430 18:55581028-55581050 GTGACTGTTTTGCATGATGTTGG - Intronic
1158305100 18:56096563-56096585 ATATCTTTCTTCAATGCTGTAGG - Intergenic
1158325177 18:56306150-56306172 ATGTCTGTCCTGGTTGAGGTAGG + Intergenic
1158537650 18:58322721-58322743 ATGCCTGCCTTGCATGCTGTGGG + Intronic
1159509008 18:69372132-69372154 ATTTCTGTCTTGCATTTTGTGGG - Intergenic
1159813654 18:73046876-73046898 TTGTCTGGTTTGAATGATTTTGG - Intergenic
1160055595 18:75476872-75476894 ATGTGAGGCTTGAGTGATGTGGG + Intergenic
1160380249 18:78449167-78449189 GTGTGTGTTTTGTATGATGTGGG - Intergenic
1164175881 19:22773996-22774018 ATCTCTGTCTGGACTCATGTTGG - Intronic
1165550474 19:36579583-36579605 ATACCTGTATTGAATGCTGTAGG + Intronic
925308278 2:2865299-2865321 CTGTCTGTCTGGAGTCATGTGGG + Intergenic
926833355 2:16989299-16989321 CTGTTTGTCATGAAGGATGTAGG + Intergenic
928327898 2:30334572-30334594 ATGTCTGTCATTGTTGATGTAGG - Intergenic
930874292 2:56196630-56196652 ATGGATGTCTTGGATGATTTAGG + Intronic
936783200 2:116059417-116059439 CTGTCTTTCTTAAATGAGGTTGG + Intergenic
939063181 2:137449286-137449308 ATGTTTGTGTAGAATGATGAAGG + Intronic
940483901 2:154273666-154273688 GTGTCTGTAATGAATGCTGTGGG - Intronic
940521135 2:154749782-154749804 ATGGCTGTCTTCAAAGATGGAGG - Intronic
940762899 2:157757352-157757374 ATTTATCTCTTGAAAGATGTGGG - Intronic
942062550 2:172241128-172241150 CTGCCTGTCTTTAAGGATGTAGG + Intergenic
942262107 2:174176975-174176997 AGGTTTGTTCTGAATGATGTGGG - Intronic
942743882 2:179210032-179210054 ATGGCAGCCTTGAATGATCTCGG - Intronic
942771374 2:179524998-179525020 ATGTCTGCCTCGAGTGATGATGG - Intronic
943494927 2:188608395-188608417 ATTTCTGTTTTCAATTATGTAGG - Intergenic
943548064 2:189306083-189306105 ATGTCTGTATTGTATGTTGGAGG - Intergenic
945517021 2:210775074-210775096 CTGTCTGTCTAGGCTGATGTGGG + Intergenic
946338311 2:219053200-219053222 ATGTCTGTGTTGAAAGTGGTGGG - Intergenic
1169128944 20:3152997-3153019 ATGTCTGTCTAGAAGGAGGCTGG + Intronic
1170441235 20:16380934-16380956 ACGTCTATCTTGGATGATGCTGG + Intronic
1171440203 20:25154538-25154560 ATATCTGTCTTCAATCATGTAGG + Intergenic
1173852734 20:46228922-46228944 GTGTCTGTCTGGAATGATCGAGG - Intronic
1175508441 20:59504261-59504283 ATGTCTGTCTTGCAAGAGGGAGG - Intergenic
1178737405 21:35165547-35165569 TTGTCTGTCATGACTGATTTAGG - Intronic
1178917097 21:36711241-36711263 ATGTGTCTCTTTAATGATTTTGG + Intronic
1180616109 22:17128762-17128784 ATGTCTCTCTTGAATTTTATTGG - Intronic
1185150892 22:49163485-49163507 ATGCCCGCCTTGAATGATGGCGG - Intergenic
950495793 3:13333573-13333595 ATGCCTGTCTTGAGAGTTGTGGG + Intronic
951278939 3:20723285-20723307 ATGTCAGTCTTTAATGAACTCGG + Intergenic
951842970 3:27054009-27054031 ATTTCTGTGAAGAATGATGTTGG + Intergenic
953558532 3:43966176-43966198 ATGTCTGCCTTGGAAAATGTGGG + Intergenic
954828643 3:53398924-53398946 ATGTATGTATTGAAGGATGGAGG - Intergenic
955418911 3:58717911-58717933 ATGCCAGTCATGACTGATGTAGG + Intronic
955658154 3:61266533-61266555 ATGACTGTCCTGAATACTGTAGG + Intergenic
955737053 3:62050328-62050350 ATGACTGTATTGAATACTGTAGG - Intronic
955999798 3:64717229-64717251 GTTTCTGGCTTGAATAATGTGGG - Intergenic
956310527 3:67874056-67874078 CTGTCTGTGTTGAATCATATAGG + Intergenic
957600454 3:82327473-82327495 ATATCAGTTTGGAATGATGTAGG - Intergenic
957955256 3:87178229-87178251 ATGTCTTTCTTGAATTTTTTTGG - Intergenic
958159284 3:89796169-89796191 GTGTCTGTATTGAAAAATGTGGG + Intergenic
959201582 3:103254717-103254739 ATGTCTGTGTGGAAAGAAGTAGG - Intergenic
961315753 3:126034333-126034355 ATTTATGTCTTGAATTTTGTTGG - Intronic
962120488 3:132555534-132555556 TTGTCTGTCTTGAATTAGGGAGG + Intergenic
963565634 3:146926696-146926718 ATTTCTGTCTTAAATTATTTGGG + Intergenic
964028959 3:152114429-152114451 ATGTCTGTATGGAATTAGGTTGG - Intergenic
964885009 3:161471980-161472002 ATAGCTTTCCTGAATGATGTGGG - Intergenic
966334466 3:178853010-178853032 ATGCCTGTGTTGAGTGATTTAGG - Intergenic
966695366 3:182784841-182784863 ATGTCTCTGTTGAATGATTAAGG + Intergenic
970724568 4:19028644-19028666 ATTTCCTTCTTGAATGATGGTGG + Intergenic
971153462 4:24058326-24058348 ATTTCTGTCTTGGATTATGTTGG + Intergenic
973548071 4:52002305-52002327 ATGTTTCTATTGAATGATGCTGG + Intronic
976786512 4:88827314-88827336 ATGCGTGTATTGAATGGTGTTGG - Intronic
977999318 4:103537787-103537809 ATTTCTGGCTTGATTGGTGTTGG + Intergenic
978871020 4:113578119-113578141 ATATCTTTCTTCAATGAAGTGGG - Intronic
979208038 4:118064921-118064943 ATTTCTGGCTTTAATGATGAAGG - Intronic
981913578 4:150009936-150009958 ATGTATGTCTTGAGGGATGTTGG - Intergenic
985112732 4:186562731-186562753 ATGTCTGTCTCTAATGTTTTGGG + Intergenic
986453682 5:7892990-7893012 ATGACAGTAATGAATGATGTGGG - Intronic
986846042 5:11754717-11754739 TTGTCTGTTTTGATTGTTGTTGG + Intronic
987519489 5:18961492-18961514 ATGTCTGTCTTGATACATTTTGG - Intergenic
987796189 5:22630223-22630245 AATTCTGTGATGAATGATGTTGG - Intronic
988131729 5:27114996-27115018 AACTCTGTCTTGCATTATGTTGG + Intronic
989136394 5:38159843-38159865 ATATCTGGCTTGATTGGTGTTGG - Intergenic
990241250 5:53818627-53818649 GTGTCTGGTTTGAATGATGTGGG + Intergenic
990633165 5:57693106-57693128 ATGTCTGTCTAGAAGGATTAAGG - Intergenic
992027783 5:72687605-72687627 ATATCTTTCTTGGATGATGAAGG - Intergenic
993323016 5:86498239-86498261 GTGCCTGACTTGCATGATGTAGG - Intergenic
993637273 5:90359839-90359861 AAGTCTTTCTTGGTTGATGTAGG + Intergenic
993782194 5:92081191-92081213 ATATCTCTCTTGGATGATTTTGG + Intergenic
994837882 5:104880896-104880918 TTTTTTGTCATGAATGATGTTGG - Intergenic
996632725 5:125654900-125654922 ATGTCTACTTTGAATGAGGTAGG - Intergenic
996975384 5:129427144-129427166 ATGTCTTTATTGAATGCTGTAGG - Intergenic
999625345 5:153514711-153514733 ATTTCTGTGAAGAATGATGTTGG + Intronic
999861093 5:155647261-155647283 ATGACTGTCCTGAATACTGTAGG + Intergenic
1002475273 5:179461690-179461712 AACTCAGTCTTGAATGGTGTAGG - Intergenic
1002934163 6:1657560-1657582 ATGTCTGTCTTTAACAATGGAGG - Intronic
1003217419 6:4127288-4127310 ATATGTGTCTTAATTGATGTTGG + Intronic
1004876393 6:19959272-19959294 TTGTTTGTTTTGAATGATTTTGG - Intergenic
1004917166 6:20342612-20342634 ATGTCAGTGTTGCAGGATGTAGG + Intergenic
1004982635 6:21043207-21043229 ATGTCTGCCTTCCATGATATTGG + Intronic
1005074571 6:21894491-21894513 ATGTCTGTAGTAAATCATGTTGG + Intergenic
1008119682 6:47597822-47597844 ATGGCTGTCTGGAATAAAGTTGG + Intronic
1008234260 6:49025542-49025564 ATGTCTGCCTTTGTTGATGTTGG + Intergenic
1009296658 6:61958864-61958886 ATGTCAGGCTTGTTTGATGTAGG - Intronic
1009577570 6:65486548-65486570 GTGTCTTTCTTGAATCATGGAGG - Intronic
1010014554 6:71089538-71089560 GTGTATGTCTTAAATGATGTTGG - Intergenic
1012035390 6:94131378-94131400 ATGTCAGTTTAGAATGTTGTTGG - Intergenic
1012702911 6:102485424-102485446 ATGTCAGTCTTGAGTAATGCAGG + Intergenic
1013980748 6:116125770-116125792 ATGTCTGTATTAAATAATCTAGG + Exonic
1014768846 6:125438433-125438455 ATGAGTTTCTTGAAGGATGTTGG - Intergenic
1016502886 6:144742154-144742176 ATATCTGTATTGAAAGATTTAGG + Intronic
1021407656 7:20291766-20291788 ATCTTTGTCTTGCATGCTGTTGG - Intergenic
1023531220 7:41156682-41156704 TTGTTTGTCTAGAATGTTGTAGG + Intergenic
1025625959 7:63221945-63221967 ATGACTGTACTGAATGCTGTAGG - Intergenic
1026390220 7:69893725-69893747 TTGTCTGCCTTGCATGAAGTGGG - Intronic
1027433048 7:78134095-78134117 TTGACTGTCTTGATTGAGGTGGG - Intronic
1027516503 7:79148323-79148345 ATCTGTGTCTTGAGTGATGTTGG + Intronic
1030850317 7:114476645-114476667 AATTCTGTCAAGAATGATGTTGG + Intronic
1031015173 7:116566888-116566910 TTGTTTGTGTTGCATGATGTAGG + Intergenic
1031703331 7:124952643-124952665 ATGTCTGGCTTCAGTGATCTAGG - Intergenic
1032659501 7:133968095-133968117 TTGTCTTTCTTGAATTTTGTTGG + Intronic
1033940446 7:146645864-146645886 CTGTCTGTCTTCAATAGTGTTGG + Intronic
1033997958 7:147375528-147375550 ATGGCTGCCTTGAGTGGTGTAGG + Intronic
1036738883 8:11344233-11344255 TTGTCTGTCTAAAATGATGTTGG - Intergenic
1037014200 8:13882132-13882154 GTGTGTGTGTTGGATGATGTTGG + Intergenic
1037040881 8:14231289-14231311 GTGTCTGTCTTGAATGTTGGAGG + Intronic
1037382192 8:18297860-18297882 ATTTCTGTGTAAAATGATGTTGG + Intergenic
1040750715 8:50702830-50702852 ATGACTGTATTGAATACTGTAGG + Intronic
1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG + Intronic
1042777898 8:72454835-72454857 AATTCTGTGTAGAATGATGTTGG + Intergenic
1044299574 8:90567945-90567967 ATGTCTGTCTGGAATAAGGGAGG - Intergenic
1046352214 8:113030243-113030265 AATTCTGTAATGAATGATGTTGG - Intronic
1049033407 8:140054260-140054282 ATGGATGTATTGCATGATGTTGG - Intronic
1050169931 9:2804698-2804720 AACTCTGTATGGAATGATGTTGG - Intronic
1050210900 9:3254932-3254954 ATGTGCTTCTTGAATTATGTGGG + Intronic
1050514402 9:6428046-6428068 ATGACTGTTTAGAATGATGATGG + Intronic
1050923718 9:11237118-11237140 ATATCTGTTATGAATGATGTTGG + Intergenic
1053480432 9:38412783-38412805 ATTTCTGGCTTTGATGATGTTGG - Intronic
1056524883 9:87433599-87433621 ATGTCTCACTTGAATGGTGAGGG - Intergenic
1056984706 9:91351890-91351912 GTGACTGTATTGAATGCTGTAGG + Intronic
1057019667 9:91686793-91686815 GTGACTGTCCTGAATGCTGTAGG + Intronic
1057051862 9:91929890-91929912 CTCTCTGTGTTCAATGATGTGGG - Intronic
1060842351 9:126803915-126803937 ATGCCTGTCTTGCTTGTTGTTGG - Intergenic
1185696388 X:2198098-2198120 ATGACTGTACTGAATGCTGTAGG + Intergenic
1185864504 X:3611274-3611296 GTGTCTGTTTCGAATGGTGTTGG + Intronic
1186428721 X:9486086-9486108 AGGTCTGTGTTAAATGCTGTCGG - Intronic
1186497923 X:10026490-10026512 AAGTCTGTCTTTGATGAGGTGGG + Intronic
1186946912 X:14578854-14578876 ATGACTGCCTGGAAGGATGTAGG + Intronic
1188248339 X:27860321-27860343 ATGTCTGTCTTGTACATTGTGGG + Intergenic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1190153631 X:47969135-47969157 ATGTCTTTCTTAAAGGAAGTGGG + Intronic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1192083258 X:68068587-68068609 ATGTCTGTTTTTAATTATCTTGG - Intronic
1192116315 X:68415076-68415098 ACGTCTGTCTTGGCTGATTTAGG + Intronic
1194015666 X:88617152-88617174 TTTTCTGTTTTGTATGATGTTGG - Intergenic
1194258165 X:91660195-91660217 ATGCCAGGTTTGAATGATGTGGG + Intergenic
1196561707 X:117157166-117157188 ATGTCTTTCTTGGAAGATGAAGG + Intergenic
1196848517 X:119915927-119915949 ATGTCTGTTTTCAATGTTGCAGG + Intronic
1198229339 X:134674522-134674544 ATGTATGGGTTGAATGCTGTAGG - Intronic
1199039532 X:143095541-143095563 GTTTCTGTTTTGAAGGATGTCGG + Intergenic
1200576928 Y:4899702-4899724 ATGCCAGGTTTGAATGATGTGGG + Intergenic
1200736943 Y:6810059-6810081 ATGTCTTTCTTAAATGAAGATGG - Intergenic