ID: 900791789

View in Genome Browser
Species Human (GRCh38)
Location 1:4685654-4685676
Sequence GCCTCTCCTTCGCTGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 205}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900791789_900791805 30 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791805 1:4685707-4685729 TGTTAGGGTGCACCGTTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 51
900791789_900791797 14 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791797 1:4685691-4685713 AGGCTCCTTGGCGCCATGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 67
900791789_900791795 2 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179
900791789_900791804 29 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791804 1:4685706-4685728 ATGTTAGGGTGCACCGTTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 49
900791789_900791803 28 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791803 1:4685705-4685727 CATGTTAGGGTGCACCGTTGGGG 0: 1
1: 0
2: 1
3: 1
4: 36
900791789_900791802 27 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791802 1:4685704-4685726 CCATGTTAGGGTGCACCGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 31
900791789_900791798 15 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791798 1:4685692-4685714 GGCTCCTTGGCGCCATGTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 49
900791789_900791794 -6 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791794 1:4685671-4685693 AGAGGCAAGCTCCACAAAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 225
900791789_900791800 26 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791800 1:4685703-4685725 GCCATGTTAGGGTGCACCGTTGG 0: 1
1: 0
2: 0
3: 5
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900791789 Original CRISPR GCCTCTCCTTCGCTGGGGCA GGG (reversed) Intronic