ID: 900791795

View in Genome Browser
Species Human (GRCh38)
Location 1:4685679-4685701
Sequence GCTCCACAAAGAAGGCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 179}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900791790_900791795 1 Left 900791790 1:4685655-4685677 CCTGCCCCAGCGAAGGAGAGGCA 0: 1
1: 0
2: 3
3: 20
4: 243
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179
900791789_900791795 2 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179
900791791_900791795 -3 Left 900791791 1:4685659-4685681 CCCCAGCGAAGGAGAGGCAAGCT 0: 1
1: 0
2: 0
3: 11
4: 152
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179
900791793_900791795 -5 Left 900791793 1:4685661-4685683 CCAGCGAAGGAGAGGCAAGCTCC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179
900791786_900791795 8 Left 900791786 1:4685648-4685670 CCAAGACCCTGCCCCAGCGAAGG 0: 1
1: 0
2: 5
3: 32
4: 298
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179
900791784_900791795 15 Left 900791784 1:4685641-4685663 CCCAAGACCAAGACCCTGCCCCA 0: 1
1: 0
2: 19
3: 46
4: 499
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179
900791792_900791795 -4 Left 900791792 1:4685660-4685682 CCCAGCGAAGGAGAGGCAAGCTC 0: 1
1: 0
2: 0
3: 13
4: 137
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179
900791783_900791795 21 Left 900791783 1:4685635-4685657 CCGGGACCCAAGACCAAGACCCT 0: 1
1: 0
2: 4
3: 62
4: 1325
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179
900791785_900791795 14 Left 900791785 1:4685642-4685664 CCAAGACCAAGACCCTGCCCCAG 0: 1
1: 0
2: 8
3: 73
4: 578
Right 900791795 1:4685679-4685701 GCTCCACAAAGAAGGCTCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900791795 Original CRISPR GCTCCACAAAGAAGGCTCCT TGG Intronic