ID: 900791803

View in Genome Browser
Species Human (GRCh38)
Location 1:4685705-4685727
Sequence CATGTTAGGGTGCACCGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 36}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900791791_900791803 23 Left 900791791 1:4685659-4685681 CCCCAGCGAAGGAGAGGCAAGCT 0: 1
1: 0
2: 0
3: 11
4: 152
Right 900791803 1:4685705-4685727 CATGTTAGGGTGCACCGTTGGGG 0: 1
1: 0
2: 1
3: 1
4: 36
900791792_900791803 22 Left 900791792 1:4685660-4685682 CCCAGCGAAGGAGAGGCAAGCTC 0: 1
1: 0
2: 0
3: 13
4: 137
Right 900791803 1:4685705-4685727 CATGTTAGGGTGCACCGTTGGGG 0: 1
1: 0
2: 1
3: 1
4: 36
900791790_900791803 27 Left 900791790 1:4685655-4685677 CCTGCCCCAGCGAAGGAGAGGCA 0: 1
1: 0
2: 3
3: 20
4: 243
Right 900791803 1:4685705-4685727 CATGTTAGGGTGCACCGTTGGGG 0: 1
1: 0
2: 1
3: 1
4: 36
900791796_900791803 0 Left 900791796 1:4685682-4685704 CCACAAAGAAGGCTCCTTGGCGC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 900791803 1:4685705-4685727 CATGTTAGGGTGCACCGTTGGGG 0: 1
1: 0
2: 1
3: 1
4: 36
900791789_900791803 28 Left 900791789 1:4685654-4685676 CCCTGCCCCAGCGAAGGAGAGGC 0: 1
1: 1
2: 0
3: 26
4: 205
Right 900791803 1:4685705-4685727 CATGTTAGGGTGCACCGTTGGGG 0: 1
1: 0
2: 1
3: 1
4: 36
900791793_900791803 21 Left 900791793 1:4685661-4685683 CCAGCGAAGGAGAGGCAAGCTCC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 900791803 1:4685705-4685727 CATGTTAGGGTGCACCGTTGGGG 0: 1
1: 0
2: 1
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900791803 Original CRISPR CATGTTAGGGTGCACCGTTG GGG Intronic