ID: 900794709

View in Genome Browser
Species Human (GRCh38)
Location 1:4700928-4700950
Sequence CTTAGCTGAGCCTCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900794709_900794710 -10 Left 900794709 1:4700928-4700950 CCAGCAGCAGAGGCTCAGCTAAG 0: 1
1: 0
2: 0
3: 25
4: 226
Right 900794710 1:4700941-4700963 CTCAGCTAAGACACAGAGCCAGG 0: 1
1: 1
2: 2
3: 34
4: 287
900794709_900794711 4 Left 900794709 1:4700928-4700950 CCAGCAGCAGAGGCTCAGCTAAG 0: 1
1: 0
2: 0
3: 25
4: 226
Right 900794711 1:4700955-4700977 AGAGCCAGGTTTCCCCTCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 269
900794709_900794712 5 Left 900794709 1:4700928-4700950 CCAGCAGCAGAGGCTCAGCTAAG 0: 1
1: 0
2: 0
3: 25
4: 226
Right 900794712 1:4700956-4700978 GAGCCAGGTTTCCCCTCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900794709 Original CRISPR CTTAGCTGAGCCTCTGCTGC TGG (reversed) Intronic
900794709 1:4700928-4700950 CTTAGCTGAGCCTCTGCTGCTGG - Intronic
901078945 1:6572793-6572815 CTGATCTGAGCCCCTGATGCTGG + Intronic
901233323 1:7653218-7653240 CTCCACTGAGCCTCTGCTGTGGG - Intronic
902239514 1:15079222-15079244 CTCAGCTGAGCCTCTTCCACAGG - Intronic
902801881 1:18835535-18835557 CAGAGCTGAACCTCTCCTGCAGG + Intergenic
904266384 1:29320615-29320637 CTGGGCTGAGCCTCTGCCCCAGG - Intronic
904364520 1:30001889-30001911 CTGAGAGGAGTCTCTGCTGCTGG + Intergenic
905003608 1:34693175-34693197 CGGAGCTGAGCCTGTGCTCCAGG - Intergenic
906564926 1:46792473-46792495 CTTATCTGATCCACTGCTGATGG - Intronic
908622008 1:65992836-65992858 CATAGCAGAGACACTGCTGCAGG - Intronic
910209946 1:84782657-84782679 CCTAGCGGAGGCTCTGCTGTTGG + Intergenic
912859382 1:113199252-113199274 ATTAGCTGAGCCACTGCTTGAGG - Intergenic
914328882 1:146647762-146647784 TTTCTCAGAGCCTCTGCTGCTGG - Intergenic
916090779 1:161306324-161306346 CTTACCTGAGCCTCCTCTGCAGG + Exonic
919471896 1:197989220-197989242 CATAGCCCAGCCTGTGCTGCCGG + Intergenic
923685490 1:236150633-236150655 CTCAGCCCAGCCTCTGCTGTGGG - Intronic
1065603049 10:27389211-27389233 CTGAGCTGGGCCTCAGCTGAGGG + Intergenic
1066068755 10:31782977-31782999 CTTAGCCCAGGCTTTGCTGCTGG - Intergenic
1066497972 10:35960708-35960730 CTTCGCTGACCCTCTGTTGCAGG - Intergenic
1069185678 10:65419537-65419559 CTGAGCTGAGCTTCAGCTGCAGG - Intergenic
1069884792 10:71616779-71616801 CTTAACTGAGCATCTGCTATGGG - Intronic
1071240917 10:83703712-83703734 TTTATCTGAGCCTGTGCTCCTGG - Intergenic
1071526242 10:86361186-86361208 CTTGCCTGGGGCTCTGCTGCAGG - Intronic
1072281046 10:93865752-93865774 CTGAGCTGAGTCTGTCCTGCAGG - Intergenic
1073117421 10:101099424-101099446 CTCAGCTCTGGCTCTGCTGCAGG + Intronic
1074994357 10:118743493-118743515 CTTAGGTGAGCCACTGCACCCGG - Intronic
1075341938 10:121653866-121653888 CTTAGCTGGGCCAGTCCTGCAGG + Intergenic
1075676819 10:124301680-124301702 CTTGTCTGAGGCTCTGCTTCTGG - Intergenic
1076399629 10:130173107-130173129 CTTTGTCGACCCTCTGCTGCGGG + Intronic
1077108222 11:850980-851002 GTTAGGGAAGCCTCTGCTGCCGG - Intronic
1078377006 11:10804303-10804325 CCTGGTTGACCCTCTGCTGCTGG + Exonic
1080656627 11:34263576-34263598 CTTCCCTGAGGCTCTCCTGCAGG + Intronic
1082097023 11:48139286-48139308 CTGCTCTGAGCCTCAGCTGCAGG - Intronic
1083383184 11:62285514-62285536 CTGAGCAGAGCCTATGCTTCAGG + Intergenic
1085265780 11:75237110-75237132 CTTCGCTGGGCCTTTTCTGCTGG - Intergenic
1090044246 11:123316992-123317014 CAGAGCTGGGCCTCTGCTCCCGG - Intergenic
1090884650 11:130865225-130865247 CTTAACTGGGCCTCTGGGGCAGG - Intergenic
1091003681 11:131932764-131932786 CTGAGCTGGGCCTGAGCTGCAGG + Intronic
1092208711 12:6632627-6632649 CTGAGCTAAGCTTCTGCTGGAGG - Intronic
1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG + Intronic
1094409645 12:30155611-30155633 CTTAGCTCAGTATCTTCTGCAGG + Intergenic
1096967018 12:55636860-55636882 CTTGGCTGTGCCTCAGCTTCTGG + Exonic
1100236582 12:92667538-92667560 ATTAGAGGAGCCTCTGCTGATGG - Intergenic
1107601370 13:42016292-42016314 CTGAGCTGAGGCTGTGCTGATGG - Intergenic
1108139856 13:47408924-47408946 CTTTCCTGAGCATCTCCTGCTGG + Intergenic
1108465245 13:50708487-50708509 CTTAGCTCAGCATCTGCTTCTGG - Intronic
1110147887 13:72215212-72215234 CTTAGTTGATCCTCTGTTGTAGG + Intergenic
1113542255 13:111118030-111118052 CTTCGCTTGACCTCTGCTGCAGG + Intronic
1113949685 13:114065152-114065174 CCCAGCTGAGCCCCTGCTCCAGG - Intronic
1114659262 14:24334471-24334493 GTGAGCCGAGCCTCTGCTGCGGG - Intronic
1115643408 14:35350119-35350141 CTTTCCTGACCCTCTGCTGCCGG + Intergenic
1117729322 14:58705678-58705700 CTTTGCCAAGCCTCTTCTGCAGG - Intergenic
1118535638 14:66760923-66760945 CTTATCCGAGCCTCTTTTGCAGG + Intronic
1118737673 14:68713731-68713753 CTTGGATGAGCCTCTGCCTCTGG - Intronic
1121471441 14:94157796-94157818 CCTCTCTGAGCCTCTACTGCAGG - Intronic
1122157480 14:99758912-99758934 CTTAGCTGTGACTTTGCTGATGG + Intronic
1122447458 14:101780509-101780531 CCCAGGTGAGCCTCTGCTGTGGG - Intronic
1123733319 15:23163824-23163846 CTCAGCTGAACCTCTGCCCCCGG + Intergenic
1123751453 15:23361216-23361238 CTCAGCTGAACCTCTGCCCCCGG + Exonic
1124283822 15:28385120-28385142 CTCAGCTGAACCTCTGCCCCCGG + Exonic
1124298875 15:28526494-28526516 CTCAGCTGAACCTCTGCCCCCGG - Exonic
1124959339 15:34383036-34383058 CTCAGCTGAGCCACTGCCCCCGG - Exonic
1124975965 15:34529257-34529279 CTCAGCTGAGCCACTGCCCCCGG - Exonic
1125639267 15:41216201-41216223 CTAAGCTGAGCCATTGCTTCTGG - Intronic
1127649709 15:60995215-60995237 CTCAGCTGAGCCAGTGCAGCTGG + Intronic
1127827348 15:62716360-62716382 CTTCTCTCAGCCTTTGCTGCTGG - Exonic
1128387890 15:67163656-67163678 CTTCCCTGAACCTCTGCTGCTGG + Intronic
1130061974 15:80576880-80576902 ATGAGCTCAGCCTCTGCAGCAGG + Exonic
1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG + Intergenic
1130690763 15:86079746-86079768 ATTAGGTGAGCCCCTGCTGTGGG - Intergenic
1130864438 15:87920373-87920395 GTTACCTGAGCATCTGCTGTAGG - Intronic
1132432983 15:101775499-101775521 CTCAGCTGAACCCCTGCTCCCGG - Intergenic
1134840370 16:17397014-17397036 CTGAACTGTGCCTCTGCAGCCGG - Intronic
1135424458 16:22325438-22325460 CGTCCCTGAGGCTCTGCTGCTGG - Intronic
1135911588 16:26566333-26566355 CATATCTGGGCCTCTGCTGAAGG + Intergenic
1136074315 16:27806420-27806442 CTTACCTGTGGGTCTGCTGCTGG - Intronic
1136605101 16:31328248-31328270 TTTAGCTGAGCCTCCACTTCTGG + Intronic
1138341591 16:56293025-56293047 CTCAGCTGAGGGTCTTCTGCTGG + Intronic
1140004686 16:71063181-71063203 TTTCTCAGAGCCTCTGCTGCTGG + Intronic
1143973565 17:10813496-10813518 CTTCCCTGAGGCTCTGCTGTTGG + Intergenic
1144260837 17:13518794-13518816 CTTGGCTGAGCCTGTGCAGAAGG - Intronic
1144836344 17:18158501-18158523 CCTAGCTCCGCCTCTTCTGCAGG + Exonic
1145060619 17:19731038-19731060 CTCAGCTCCGCCTCTGCTGTGGG - Intergenic
1145813612 17:27780400-27780422 CTTAGCTGTCCCTCTCCTGTCGG - Intronic
1145973877 17:28973178-28973200 CTTCTCTGAGCCTCTGTTACTGG - Intronic
1146223526 17:31047211-31047233 CTTGGCGGAGCCTCTGCTTTGGG + Intergenic
1146341459 17:32022757-32022779 CTTGGCGGAGCCTCTGCTTTGGG - Exonic
1146565022 17:33905466-33905488 CATAGCTTGTCCTCTGCTGCTGG + Intronic
1146812167 17:35912679-35912701 CTTGGCGGAGCCTCTGCTTTGGG + Intergenic
1147232943 17:39032369-39032391 CTCAGCGGAGCCTCTGCTTTGGG - Intergenic
1147454104 17:40524432-40524454 CTTCTCTGTGCCTCTGCTGGTGG - Intergenic
1147615122 17:41822950-41822972 CTGAGCTGACCCTGGGCTGCTGG + Exonic
1147671567 17:42179905-42179927 CTTAGCTGAGTCTCTGTCCCTGG - Intronic
1147921926 17:43922822-43922844 CTTGGCGGAGCCTCTGCTCTGGG + Intergenic
1148173879 17:45547773-45547795 CTTGGCGGAGCCTCTGCTCTGGG + Intergenic
1148275389 17:46297674-46297696 CTTGGCGGAGCCTCTGCTCTGGG - Exonic
1148297494 17:46515253-46515275 CTTGGCGGAGCCTCTGCTCTGGG - Exonic
1148966395 17:51439601-51439623 CATAGCCGAGCCTGTGCTCCTGG + Intergenic
1149641081 17:58203226-58203248 CATCGCTGAGCCTCTTTTGCCGG + Exonic
1150405092 17:64894695-64894717 CTTGGCGGAGCCTCTGCTCTGGG + Exonic
1151727398 17:75892840-75892862 CTCAGCTGGGCCTGTGGTGCGGG + Exonic
1152648141 17:81479732-81479754 CACAGCTGGGCCTCTGCCGCAGG - Intergenic
1152760519 17:82105000-82105022 CTGAGCTGAGGCTCAGGTGCAGG - Intronic
1155919974 18:31593864-31593886 CTTAGCAGTTCCTCTTCTGCTGG - Intronic
1156136758 18:34049564-34049586 GTAAACTGAACCTCTGCTGCTGG - Intronic
1157910400 18:51612704-51612726 CTTATCTGAGCCCCTCTTGCAGG - Intergenic
1160474039 18:79166826-79166848 CTTTGCTTAGCTTGTGCTGCCGG + Intronic
1161288578 19:3480778-3480800 CTCAGCTCAGCCCCTGCAGCAGG - Intergenic
1161656160 19:5516458-5516480 CTTAGCTGGTCCTCTGTTCCAGG + Intergenic
1162930041 19:13953022-13953044 CTTTGCAGAGCCCCTGCCGCTGG + Intronic
1163303924 19:16465291-16465313 GTGACCTGAGCCTCTGCTGTGGG + Intronic
1163664982 19:18598944-18598966 ACTAGCTGAGCCTCGGCTGAGGG + Intronic
1164646049 19:29859250-29859272 CTCAGGGGAGCCTCTCCTGCTGG - Intergenic
1168649710 19:58085438-58085460 CCCAGCCGAGCCTCAGCTGCCGG + Intronic
925187653 2:1860234-1860256 CTTAGCCGCTCCACTGCTGCTGG - Intronic
928122842 2:28595865-28595887 CACAGCCGAGCCTCTTCTGCAGG - Intronic
928172418 2:29012158-29012180 GGAAGCTGAGCCTCTGCTGCAGG + Intronic
928471911 2:31583186-31583208 CTTAGCTGAGGCTCTCATCCTGG + Intergenic
935513502 2:104005447-104005469 TTTACCTGAACCTCTGCTGATGG - Intergenic
940366124 2:152851183-152851205 TTCAGCTGTGCCTCTGCTGAAGG + Intergenic
941752113 2:169144425-169144447 CTTCCCTGAGCATCAGCTGCCGG + Intronic
943552381 2:189356979-189357001 CTTACATGCCCCTCTGCTGCAGG + Intergenic
943673849 2:190697198-190697220 CTTTGGGAAGCCTCTGCTGCAGG - Intergenic
947128564 2:226897547-226897569 CAAAACTGAGCCTCTGCTGAAGG + Intronic
947564740 2:231186480-231186502 CTCAGCTCTGTCTCTGCTGCTGG - Intergenic
948882715 2:240868694-240868716 CTTATCTGTGCTTGTGCTGCGGG - Exonic
1170075727 20:12416635-12416657 CTTAGCTGGGTCTCTGCTCAGGG - Intergenic
1171420993 20:25017627-25017649 CCCAGCTGAGCCTCTGCTGGGGG + Intronic
1171481915 20:25460778-25460800 CTCGGCTGAGCCTCTGCACCTGG - Intronic
1172930929 20:38586071-38586093 CTCAGCTGGGCCTTTGCTCCAGG - Exonic
1173325970 20:42034116-42034138 CTTAGCTGGGTCTTTGCTTCAGG + Intergenic
1173965706 20:47110915-47110937 CTTTGCTGAGACCCTGCTGTGGG - Intronic
1176346506 21:5753117-5753139 CTTAGCTATGCCTCTCCTCCCGG - Intergenic
1176353320 21:5873701-5873723 CTTAGCTATGCCTCTCCTCCCGG - Intergenic
1176429510 21:6567314-6567336 CCTTGCTGAGCCTGTGCTGCTGG - Intergenic
1176498321 21:7571338-7571360 CTTAGCTATGCCTCTCCTCCCGG + Intergenic
1176540827 21:8151187-8151209 CTTAGCTATGCCTCTCCTCCCGG - Intergenic
1176559778 21:8334232-8334254 CTTAGCTATGCCTCTCCTCCCGG - Intergenic
1177900951 21:26914445-26914467 CTCAGCTGGGCCTCTGCTCTGGG + Intergenic
1178136578 21:29634694-29634716 CTTTCCTGAACCTCTGCTGGAGG - Intronic
1179277372 21:39904636-39904658 CAGAGCTGAGTCACTGCTGCAGG - Intronic
1179704904 21:43174776-43174798 CCTTGCTGAGCCTGTGCTGCTGG - Intergenic
1179920831 21:44506472-44506494 CCTGTCTGAGCCCCTGCTGCAGG - Intronic
1180717723 22:17883109-17883131 CTTAGTTGAGGATCTGTTGCAGG - Intronic
1182899378 22:33885300-33885322 CTTAGCTGACCCTCTGCGGAGGG + Intronic
1182954792 22:34413211-34413233 CTTTCCTGATCCTCTGCCGCTGG + Intergenic
1183061872 22:35341096-35341118 ATTTGCTGAGCCTGTGCTCCGGG + Intronic
1183097737 22:35563460-35563482 CTGAGCTGAGCCTGGGCTGCGGG + Intergenic
1183884036 22:40862048-40862070 CTCAGCTCAGGCTCTGCTGGTGG + Exonic
1184149592 22:42630516-42630538 CTTCCTGGAGCCTCTGCTGCAGG + Intronic
1185164879 22:49255400-49255422 CTTCGCTGGGGGTCTGCTGCCGG - Intergenic
1203245767 22_KI270733v1_random:67605-67627 CTTAGCTATGCCTCTCCTCCCGG - Intergenic
950012435 3:9732543-9732565 CTCGCCTGTGCCTCTGCTGCCGG + Intronic
950161779 3:10765795-10765817 CTTGTCTCAGGCTCTGCTGCTGG - Intergenic
951941389 3:28082615-28082637 CTCAGATGAGCCTGTGCTGCTGG - Intergenic
953729594 3:45435425-45435447 CTTCGCTAAGCCTTTGCTGGTGG + Intronic
953754572 3:45635410-45635432 CTTAGCCCAGCCTTTGCTGATGG - Intronic
954914168 3:54134874-54134896 CCAAGCTGAGCAGCTGCTGCGGG + Intronic
955485074 3:59426841-59426863 CCCAACAGAGCCTCTGCTGCTGG + Intergenic
957435680 3:80172635-80172657 CTCAGCTGAGCCTCTTCTGATGG + Intergenic
957708019 3:83815316-83815338 CATAGCTGAGCCTCAGATCCAGG + Intergenic
961097288 3:124168534-124168556 CTTGGCTGAGCCACTGATCCAGG - Intronic
961866546 3:129957466-129957488 CTTGGCTCACCCGCTGCTGCTGG - Intergenic
963005914 3:140726149-140726171 CTCAGATGAGCCTGAGCTGCAGG + Intergenic
965507332 3:169530968-169530990 CATGACTGAGCCTCTCCTGCAGG + Intronic
965727937 3:171739201-171739223 CTTAGCTGGGTCTCTCCTGCAGG + Intronic
966187908 3:177244741-177244763 CTTATCTGAGGCTGTGCTGGAGG - Intergenic
968453640 4:686675-686697 CAAAGCTGAGCCACAGCTGCAGG + Exonic
971910040 4:32784185-32784207 CTTAGCTGGTCCTCTGATGAGGG + Intergenic
972416005 4:38841311-38841333 CAGAGATGAGCCTCTGCTCCCGG - Intronic
972704926 4:41532916-41532938 CTTAGCTGGGTCTCTGGTTCAGG + Intronic
974988915 4:69061466-69061488 CTTAGCTATGCCTCTCCTCCTGG + Intronic
975784510 4:77873632-77873654 CTTTGTTGAGCATCTGCTGTAGG + Intronic
981100578 4:140825567-140825589 GTTAGCTGCACCTCAGCTGCAGG + Intergenic
981205273 4:142033363-142033385 TTGACCTCAGCCTCTGCTGCTGG - Intronic
981976806 4:150739931-150739953 CTTAGCTGGGCCTCTCCTTCAGG - Intronic
985855120 5:2418312-2418334 CAAAGCTGGGCCTCTGCCGCTGG - Intergenic
986556442 5:9014732-9014754 CATAACTGAGCCTCTCCAGCTGG + Intergenic
989332689 5:40278390-40278412 CTTAGCTCAGGCTCTGCTCATGG + Intergenic
990866390 5:60385148-60385170 CTTAGCTCAGGCTCTACTTCTGG - Intronic
992019888 5:72612130-72612152 CTTAGCTCAGCCCCTGCTGATGG + Intergenic
994116374 5:96065773-96065795 CTTAGCTCTGCCCCTGCTGTGGG + Intergenic
996053082 5:118953764-118953786 CTTAGATGACCCTTTTCTGCTGG - Intronic
998068905 5:139181297-139181319 CCTAGTTGAGCCTCTGTTTCTGG - Intronic
999204503 5:149838410-149838432 CTTCGCTGAGCCTCTCTTTCTGG + Intronic
1000165821 5:158647751-158647773 CTTAGCAGTGCCTCTCCTGTTGG + Intergenic
1001156985 5:169281107-169281129 CCAAGCTGAGCTTCTGTTGCTGG + Intronic
1001882481 5:175256595-175256617 GTTAGTTGAGCATCTACTGCAGG - Intergenic
1002133104 5:177093217-177093239 CTTGGCTGTGCTCCTGCTGCTGG + Exonic
1006386928 6:33736327-33736349 GCAAGCTGAGCCACTGCTGCTGG + Intronic
1006892305 6:37439383-37439405 CTTAGCTGTGCATCTGGTGTAGG + Intronic
1007620844 6:43213583-43213605 CCGGGCTGAGCCTCTGCTGCTGG + Intronic
1011128491 6:84031717-84031739 CTTGGCAGAGGCTCTACTGCAGG + Intergenic
1011897941 6:92255496-92255518 CATAGCTGAGCCTCTACTTCAGG - Intergenic
1013318432 6:108963573-108963595 CTTTGCTCAGCGTCTGCTGAGGG + Intronic
1016321149 6:142847104-142847126 CTTAGTGGAGCATGTGCTGCTGG - Intronic
1016375826 6:143419571-143419593 CTAAGCTGAGCCACTGTGGCTGG + Intergenic
1017953713 6:159160590-159160612 TCTAGCTGAGGCTTTGCTGCTGG - Intergenic
1022256660 7:28665151-28665173 CCTAGCTTGACCTCTGCTGCTGG + Intronic
1022357217 7:29627525-29627547 TTTAGCTGAGCCTCAGGTACCGG - Intergenic
1023636731 7:42219593-42219615 CTCAGCTGAGTATCTGCTCCTGG - Intronic
1023993727 7:45146146-45146168 CTCAGCTGTGCCTCTGCACCCGG + Intergenic
1026807971 7:73439599-73439621 TTTTGCTGAGCCACTGCTGTGGG - Intergenic
1029588809 7:101493354-101493376 CTGAGCTGAGCCTTTGCAGATGG - Intronic
1029672456 7:102043015-102043037 GTGAGCTGAGACTGTGCTGCTGG - Intronic
1030126099 7:106153795-106153817 CTAAGTTCAGCCTCTGCTGGGGG - Intergenic
1032135383 7:129272156-129272178 CTCAGCTGAGCCTCTCCATCTGG - Intronic
1032574504 7:133038647-133038669 CTTAGCTTAACCTCAGCTGATGG - Intronic
1034491311 7:151394460-151394482 CTTCGCTGAGCATCAGGTGCTGG + Intronic
1035704848 8:1667848-1667870 CCTAGCTGTGTCTCTGCTGCTGG + Intronic
1035704870 8:1668014-1668036 CCTAGCTGTGTCTCTGCTGCTGG + Intronic
1035704878 8:1668097-1668119 CTTAGCTGTGTCTCTGCAGCTGG + Intronic
1036031828 8:4982145-4982167 CTTAGCTGGGTCTCTGCTTAAGG - Intronic
1038425793 8:27463074-27463096 CAAGGCTGAGGCTCTGCTGCAGG - Exonic
1039563212 8:38529530-38529552 CTTGTCTGGGCCTCTGGTGCCGG - Intergenic
1041288398 8:56284045-56284067 CTCATCTCAGGCTCTGCTGCTGG - Intergenic
1041643014 8:60222747-60222769 CTGTGCAGACCCTCTGCTGCGGG - Exonic
1042013613 8:64281104-64281126 CTTAGTTCAGCCTCTGCAACTGG + Intergenic
1043160618 8:76841943-76841965 CTTAGCTATGCCACTGCTGGTGG - Intronic
1045342409 8:101266577-101266599 CCTCCCTGAGCCTCTGCTCCAGG + Intergenic
1045764124 8:105646873-105646895 CTTTGCTGAGCCTGTGCCCCTGG + Intronic
1048850752 8:138643055-138643077 CTGGGCTTAGCCTCTGCTGAGGG - Intronic
1049690364 8:143956060-143956082 CCTATCTCAGCCTCTGCAGCTGG + Intronic
1049753151 8:144295152-144295174 CCTAGAAGAGCCTCTGCTGGTGG - Intronic
1050425511 9:5508926-5508948 CTTACCTGACCCTCTGTTCCTGG - Intergenic
1050682224 9:8125194-8125216 CTTACATGATCCTTTGCTGCAGG - Intergenic
1053168164 9:35859293-35859315 CTTAGGGTACCCTCTGCTGCAGG - Intergenic
1053488710 9:38483200-38483222 CTTAGCAGATCCTCTGCTCAGGG - Intergenic
1054912554 9:70467286-70467308 CTTACCTTTGCCTCTGCTGGGGG + Intergenic
1055139349 9:72858184-72858206 TGCAGCTGAGCCTCTGCAGCTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060272237 9:122152938-122152960 CTTTGCTGAGTTTCTGCTGCTGG + Intronic
1061152309 9:128835868-128835890 CCTACCTGCGCCCCTGCTGCAGG - Exonic
1061863246 9:133478610-133478632 AGTGGCTGAGCCTCTGGTGCTGG + Intronic
1203462104 Un_GL000220v1:50678-50700 CTTAGCTATGCCTCTCCTCCCGG - Intergenic
1186517712 X:10178740-10178762 CATAGCTGAGCCTGGGCTGTCGG + Intronic
1187109646 X:16283600-16283622 CTCAGCTGGGCTGCTGCTGCTGG + Intergenic
1187205530 X:17177657-17177679 CCTATCTCAGGCTCTGCTGCTGG + Intergenic
1190625860 X:52337787-52337809 CATAGCACAGCCTCAGCTGCAGG + Intergenic
1190725651 X:53189012-53189034 CTTAGCTGAGTTTCTGTTTCAGG - Intergenic
1192267824 X:69552015-69552037 TTTAGCTGGTCCTCTGCTCCAGG - Intergenic
1192311120 X:70014782-70014804 CTTAGCTTAGTCTATTCTGCTGG - Intronic
1192886206 X:75337281-75337303 CTTACCTGTACCTCTGCTGAAGG + Intergenic
1196099381 X:111831634-111831656 CTTCACTGAGCCACAGCTGCTGG - Intronic
1197841964 X:130757843-130757865 CTTAGCTCAGCCTCTCCTGTAGG + Intronic
1198134126 X:133729678-133729700 CTTAGCTAAGCATTTGCTACTGG + Intronic
1198531000 X:137549585-137549607 TCTAGCTGAGCCTCTGGTTCAGG + Intergenic
1200887270 Y:8281978-8282000 CCTACCTGAGCTTCTGCAGCTGG + Intergenic
1201572081 Y:15425455-15425477 CTTAGCTATGCCTCTCCTCCTGG + Intergenic
1201867825 Y:18673510-18673532 CTGAGCTCAGTCTCTGCGGCGGG - Intergenic
1202379069 Y:24260678-24260700 CCTCTCTGAGCCTCAGCTGCTGG - Intergenic
1202491713 Y:25409443-25409465 CCTCTCTGAGCCTCAGCTGCTGG + Intergenic