ID: 900795445

View in Genome Browser
Species Human (GRCh38)
Location 1:4705483-4705505
Sequence CAAAGATTCTGGAAAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 282}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900795439_900795445 14 Left 900795439 1:4705446-4705468 CCTCCAAGAATGTGCATTGTGCT 0: 1
1: 0
2: 1
3: 15
4: 176
Right 900795445 1:4705483-4705505 CAAAGATTCTGGAAAGGAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 282
900795440_900795445 11 Left 900795440 1:4705449-4705471 CCAAGAATGTGCATTGTGCTTAG 0: 1
1: 0
2: 0
3: 18
4: 212
Right 900795445 1:4705483-4705505 CAAAGATTCTGGAAAGGAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 282
900795435_900795445 20 Left 900795435 1:4705440-4705462 CCTCCCCCTCCAAGAATGTGCAT 0: 1
1: 0
2: 1
3: 21
4: 215
Right 900795445 1:4705483-4705505 CAAAGATTCTGGAAAGGAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 282
900795438_900795445 15 Left 900795438 1:4705445-4705467 CCCTCCAAGAATGTGCATTGTGC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 900795445 1:4705483-4705505 CAAAGATTCTGGAAAGGAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 282
900795437_900795445 16 Left 900795437 1:4705444-4705466 CCCCTCCAAGAATGTGCATTGTG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 900795445 1:4705483-4705505 CAAAGATTCTGGAAAGGAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 282
900795436_900795445 17 Left 900795436 1:4705443-4705465 CCCCCTCCAAGAATGTGCATTGT 0: 1
1: 0
2: 2
3: 26
4: 229
Right 900795445 1:4705483-4705505 CAAAGATTCTGGAAAGGAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900795445 Original CRISPR CAAAGATTCTGGAAAGGAGC AGG Intronic
900795445 1:4705483-4705505 CAAAGATTCTGGAAAGGAGCAGG + Intronic
902989571 1:20177190-20177212 AAAAGAATCAGGAAAGGAACGGG - Intronic
903578596 1:24354359-24354381 CTAAGATTCTGGAATGGAAGAGG - Intronic
904313749 1:29646492-29646514 CTGAGCTTCTGGAAAGGAGCAGG - Intergenic
904612172 1:31731759-31731781 GAAAGATTCTGGTAAGAATCTGG + Intronic
905590272 1:39157264-39157286 CTAAGATAATGGAAAGGGGCTGG - Intronic
905945268 1:41896515-41896537 CAAGGAACTTGGAAAGGAGCTGG - Intronic
906600444 1:47123590-47123612 CAAAGGTGCTGGAAAGGATGTGG - Intergenic
906675277 1:47688760-47688782 GACAGAACCTGGAAAGGAGCTGG - Intergenic
906709883 1:47921391-47921413 GAAGGAATCTGGAAAGGACCTGG - Intronic
908479849 1:64528010-64528032 AATAAATTCTGGAAAGGAGTGGG + Intronic
908893733 1:68875694-68875716 CAAAGACTTTGCAAAGGAGGTGG - Intergenic
909606280 1:77511805-77511827 CAAAGTTGCTAGAAAGGGGCTGG + Intronic
909985055 1:82151235-82151257 CAGAGATTATGGAAAGTGGCCGG - Intergenic
912687607 1:111779442-111779464 AGGAGGTTCTGGAAAGGAGCAGG + Intronic
913088545 1:115460355-115460377 CTATGACTATGGAAAGGAGCAGG + Intergenic
914870388 1:151469018-151469040 GAAAAATTCTTGAAAGGAGTGGG + Intergenic
914902820 1:151721002-151721024 TAAAGATGCTGGAAAGGACCTGG - Intronic
914912453 1:151798897-151798919 GGAAGGTTATGGAAAGGAGCGGG + Intergenic
914926088 1:151889314-151889336 CAAAGCTTCTGGTGAAGAGCTGG + Exonic
915216840 1:154346119-154346141 CAAAGACTTTGGAAAGGAGGAGG + Intronic
915615924 1:157038268-157038290 CCCAAATACTGGAAAGGAGCAGG + Intronic
916804686 1:168247816-168247838 CACAGATGCTGGAAAGGACAGGG - Exonic
917155471 1:171993480-171993502 AAAAGAATCTTGAAAGCAGCAGG - Intronic
917686425 1:177421223-177421245 TAAAAATTGTGGAAAGGAGGAGG - Intergenic
919408071 1:197209246-197209268 CAAAGTTTCTGGACAGAACCTGG - Intergenic
923794569 1:237141785-237141807 CAAACATCCTGGAGAGGATCCGG - Intronic
924321769 1:242858101-242858123 CAGAGGTTCTGGAAAAGGGCCGG + Intergenic
924942459 1:248821549-248821571 TAGAGAGTTTGGAAAGGAGCAGG + Intronic
1064181100 10:13116458-13116480 CAAATATTCTGGAAAGATCCTGG - Intronic
1065241822 10:23713061-23713083 CTAAGAGTATGGAAAAGAGCTGG + Intronic
1065713765 10:28544176-28544198 CAAAAAATCTGGAAAGAAGTGGG - Intronic
1065731123 10:28710599-28710621 CAAAGGTTCTGGAAATGTGCAGG + Intergenic
1067319832 10:45207149-45207171 CAAAACTTCTGGAAAGTAACGGG - Intergenic
1068348180 10:55811621-55811643 CATAGATTCTAGAAAAGACCCGG - Intergenic
1069585854 10:69601453-69601475 CACAGAGTCTGGAAAGAAGTTGG - Intergenic
1070109337 10:73467919-73467941 CAAACATTCTGGAAAGAATCTGG - Intronic
1070714683 10:78710751-78710773 CAAAAAATCTGGAAAGCACCTGG + Intergenic
1071351938 10:84755297-84755319 CAACATTTATGGAAAGGAGCTGG + Intergenic
1071769479 10:88709810-88709832 GTAAGATTCAGGAAAGGAGAGGG + Intergenic
1072014498 10:91333466-91333488 GAAAGATTCTTGAAAGGAGTAGG + Intergenic
1073592753 10:104772142-104772164 AGAGGATTCTGGAAAGGAGGTGG - Intronic
1075286069 10:121187309-121187331 CAAAGATTGAGGATAGGAGAAGG - Intergenic
1075369817 10:121926679-121926701 CAAAAATTCTGAAAAAGAGAAGG + Intronic
1075705991 10:124501303-124501325 CAAATATTCTGGAACTGGGCCGG + Intronic
1076398503 10:130160244-130160266 CTAAGATGCTGGCAAGCAGCTGG - Intronic
1076523603 10:131096249-131096271 CAAGGGCTCTGGAAAGGTGCTGG - Intronic
1076896101 10:133313040-133313062 CACAGATTTTGGAAACGACCTGG + Exonic
1077902107 11:6497916-6497938 CAAAGACTCTGGTAAGGAGCAGG - Exonic
1079323373 11:19470976-19470998 CAAAGTGTCTGGAAGGGATCTGG + Intronic
1081234611 11:40632370-40632392 CAAAGCTTCTGAAAAGTTGCTGG + Intronic
1083294411 11:61707443-61707465 CATAGAGACTGGAAAGGAGAGGG - Intronic
1085142558 11:74160575-74160597 CAAAGATTAGGGAAGGTAGCAGG + Intronic
1087366479 11:97226229-97226251 CAAAAATATTGGAAATGAGCTGG - Intergenic
1087661068 11:100988323-100988345 CAAAAATTCTGGAATGTAGAGGG - Intronic
1090285681 11:125496766-125496788 CAAAGATGCTGGGTGGGAGCTGG + Exonic
1090540321 11:127695395-127695417 CAATGGTTCAGGAATGGAGCAGG + Intergenic
1093251549 12:16810995-16811017 CAAAGACTTTGCAAAGGAGATGG + Intergenic
1093681521 12:22008484-22008506 CAAAGCTTCTGGTGAAGAGCTGG - Intergenic
1093747459 12:22759601-22759623 CAACCATTTAGGAAAGGAGCAGG + Intergenic
1094730537 12:33169574-33169596 CACAGATGCTGGAAAGGATGTGG + Intergenic
1094758381 12:33498441-33498463 CACAGATGCTGGAAAGGATGTGG + Intergenic
1095792506 12:46182611-46182633 CTAAGATGCTGGAGAGGAGTTGG + Intergenic
1097752563 12:63372605-63372627 AAAAAATTCAGGAGAGGAGCAGG + Intergenic
1098216815 12:68229145-68229167 CTAAGATTCTGCACAGGAGTTGG - Intergenic
1098256102 12:68617019-68617041 GAAAGCTTCTGGAAAGGAAATGG + Intronic
1098376940 12:69825987-69826009 CCTAGATTCTGTAAATGAGCAGG - Intronic
1100665563 12:96748607-96748629 CAAAGATTCTGCTACTGAGCTGG - Intronic
1100683775 12:96961948-96961970 CAAAGAATCTTGAAAGCAGAAGG + Intergenic
1100860010 12:98794642-98794664 AAAGCATTCTGGAAAGCAGCTGG + Intronic
1102134733 12:110564188-110564210 CAATGTTTCTGGACAGGAGGAGG + Intronic
1103497321 12:121373166-121373188 CAAAGATTCTGGAACAGGCCAGG + Intronic
1104134855 12:125927713-125927735 CAAAGTTTCTAGAAAGGGGGCGG - Intergenic
1104335806 12:127893864-127893886 CAAGGATCCTGGGAGGGAGCTGG - Intergenic
1105756122 13:23466218-23466240 CAAGGAGTCTGGAAATAAGCGGG + Intergenic
1106939743 13:34764675-34764697 CAAACTTTCTGGAAAGGGCCAGG - Intergenic
1107196478 13:37658779-37658801 AAAATAACCTGGAAAGGAGCAGG + Intronic
1107296368 13:38913475-38913497 CACAGATTATGGAAAGGAAAAGG + Intergenic
1109157033 13:58924105-58924127 AAAAGATTCTCGAGAAGAGCAGG - Intergenic
1109374222 13:61468822-61468844 CAAAGATAATGGAAAACAGCAGG + Intergenic
1112280851 13:98061764-98061786 CGCACGTTCTGGAAAGGAGCCGG + Intergenic
1113299891 13:109006908-109006930 CGAAGAGTCGGGAAAGGAGATGG + Intronic
1114778021 14:25507974-25507996 TAAAGATACTGAAAAGGAGAAGG - Intergenic
1114845376 14:26314399-26314421 CAAAGATGCTGGAGAGGATGTGG + Intergenic
1116191073 14:41667559-41667581 TATAGATTCAGGAAAGGGGCAGG - Intronic
1116550822 14:46235397-46235419 CAAACATCCTGGAAATGAGATGG - Intergenic
1117874744 14:60240427-60240449 CGTAGACTCTGGAATGGAGCTGG - Intergenic
1117992625 14:61449392-61449414 CAAAGAATGTGGAAGGGAGGTGG - Intronic
1118598890 14:67457646-67457668 CACAGACTTTGGAAAGCAGCCGG + Intronic
1118984695 14:70743704-70743726 CAAAGATGCTGGAGAGGATGTGG + Intronic
1119147483 14:72330305-72330327 CAACACTTCTGCAAAGGAGCAGG + Intronic
1119571605 14:75679090-75679112 CACAGATTCTGGAAATTAGAAGG - Intronic
1121076903 14:91076612-91076634 CAAAGCTACTGGGAAGGATCTGG + Intronic
1121872857 14:97425529-97425551 GCTAGGTTCTGGAAAGGAGCAGG + Intergenic
1125190962 15:36992754-36992776 CAAACAATCTGGAAAGGATTTGG + Intronic
1125478627 15:40064554-40064576 CAGAGATTCTCAAAAGAAGCTGG - Intergenic
1127088072 15:55443009-55443031 CAAAGCTTCTGGTGAAGAGCTGG + Intronic
1136864158 16:33729116-33729138 CAAAGAGTCAGGAAAGAATCTGG + Intergenic
1136926663 16:34381168-34381190 CCAAGCTGCTGGAGAGGAGCCGG - Intergenic
1136977911 16:35030639-35030661 CCAAGCTGCTGGAGAGGAGCCGG + Intergenic
1140330784 16:74054841-74054863 CAAAGATTTTAGATAGGAGGAGG + Intergenic
1140488144 16:75310736-75310758 AAGAGGTACTGGAAAGGAGCTGG + Intronic
1203125646 16_KI270728v1_random:1577254-1577276 CAAAGAGTCAGGAAAGAATCTGG + Intergenic
1143862372 17:9900233-9900255 CAAGGATGCGGTAAAGGAGCTGG - Intronic
1146038684 17:29431050-29431072 CACAGATTCTAGAACAGAGCAGG - Intronic
1149855735 17:60080988-60081010 CGAAGAGACTGGAAAGGATCTGG + Intergenic
1151266604 17:72961239-72961261 CAAAGATGCTGGAGAGGACGTGG + Intronic
1151388460 17:73769939-73769961 CAATGATTCTGGGAATCAGCTGG + Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1153204178 18:2679140-2679162 CAAAAATAATGGAAAGGGGCCGG - Intronic
1158186091 18:54773419-54773441 CAAAGCTTCTGCAAAGGAAAGGG + Intronic
1158820656 18:61154857-61154879 CAAAGTTTCTTGAGAGGACCCGG + Intergenic
1158854632 18:61530811-61530833 CACACATTCTGGGAAGGAACTGG - Intronic
1159101485 18:63963611-63963633 GAAGGATTCTGGAGAGGATCAGG + Intronic
1159212690 18:65347519-65347541 TAAAGATTCTGGAGTAGAGCTGG - Intergenic
1159666617 18:71169303-71169325 CAAAGATTCCTTAAAGGAGGAGG + Intergenic
1164486259 19:28658149-28658171 CCAAGTTTCTGGAAGGGAGAGGG - Intergenic
1164647473 19:29870208-29870230 CAATGATTCTTGAGGGGAGCAGG - Intergenic
1166147049 19:40845098-40845120 CAAAGAGTCTGGAGAGATGCAGG + Intronic
1166871921 19:45876513-45876535 CAGAGATCCAGGAAAGGAGTGGG - Intergenic
1167069484 19:47212049-47212071 CAAGGATTCTGAAAAGTACCAGG - Intergenic
1167759853 19:51439183-51439205 CAAGGATGCTGGTAGGGAGCAGG + Intergenic
925918916 2:8626033-8626055 TCCAGCTTCTGGAAAGGAGCTGG - Intergenic
932657326 2:73621338-73621360 CAGAGATGCTGGAAAAGACCAGG + Intergenic
933612698 2:84453819-84453841 CTAAGAATCTGGAAAGAAGGAGG - Intronic
934632376 2:95942044-95942066 CAAAGAGTCAGGAAAGAATCTGG + Intronic
934801126 2:97161218-97161240 CAAAGAGTCAGGAAAGAATCTGG - Intronic
937874945 2:126817047-126817069 CAAAGAGTCTTGAAAGCAGCAGG - Intergenic
938373753 2:130790692-130790714 CAAACAATATGGAAAGGGGCTGG + Intergenic
940368181 2:152871994-152872016 CTGAGATTCTGGCAAAGAGCTGG - Intergenic
941706329 2:168662431-168662453 CAAAGACCCTGGAAAGGGCCAGG + Intronic
942570490 2:177309424-177309446 CAAGGCTTCTGGAATGGGGCAGG - Intronic
942810388 2:179992363-179992385 CAAAGAATCTAGAGTGGAGCAGG - Intronic
943665165 2:190601472-190601494 CAAAGCTCCTGGAAGGGTGCTGG + Intergenic
943979143 2:194524461-194524483 AACAGATTCTGGAAAGGATGTGG + Intergenic
945587736 2:211687626-211687648 CAAAGAATCTGGAAAGGGGCAGG - Intronic
946355463 2:219181797-219181819 CAAAGATTGTGGCGGGGAGCAGG - Intronic
946686862 2:222279378-222279400 CAGGGATTCAGGAAAGGAGAGGG + Intronic
946955369 2:224923793-224923815 GAAAGCTTTTGAAAAGGAGCTGG - Intronic
1168868029 20:1105645-1105667 CAAAGGTTTTGGCATGGAGCTGG + Intergenic
1169202100 20:3716371-3716393 CAGAGATACTGGCAAGGAGGTGG - Intergenic
1169204069 20:3730372-3730394 CAACCATGCTGGAGAGGAGCAGG + Intergenic
1170192329 20:13656525-13656547 CAATGAATCTGGAAAGCAGATGG - Intergenic
1170949357 20:20922003-20922025 CAAAAATTCAGCAAAGGAGTGGG + Intergenic
1172895455 20:38296643-38296665 CAGACATTCTGCAAAGCAGCTGG + Intronic
1172971895 20:38879803-38879825 CAGAGGTTCTAGAAGGGAGCAGG + Intronic
1174224270 20:48984266-48984288 CAAACATTCTGGAGAGGAGGAGG + Intronic
1174510413 20:51047165-51047187 CTAAGATACTGGAAATGAGAGGG + Intergenic
1174554170 20:51382286-51382308 CAAAGAAGCTGGAAAGGATGAGG + Intergenic
1175449144 20:59047606-59047628 CAAAAAGACTGGAAAGGAGAAGG - Intergenic
1177185320 21:17787103-17787125 CAAAGAAACTGGATAGGAGAAGG - Intergenic
1177799606 21:25815192-25815214 CACAGATTTTGGCAATGAGCAGG - Intergenic
1178721286 21:35011903-35011925 AACGGATTCTGGAAAGCAGCTGG + Intronic
1180742849 22:18065738-18065760 CAATGGCTCTGGAAAGGAGGTGG + Intergenic
1182336304 22:29585709-29585731 AAAAGATTCTGGGATGGAGTGGG - Intergenic
1183713309 22:39519638-39519660 CCTAAACTCTGGAAAGGAGCCGG - Intergenic
1184781563 22:46652211-46652233 CAAAGGTTCTGAGAAGGAGATGG + Intronic
1185093541 22:48791726-48791748 CAAAGCTTCTAGAAAGAAACAGG - Intronic
950248698 3:11445790-11445812 CCAAGATTCTGGCAAGGATAAGG - Intronic
953101712 3:39836235-39836257 CAAAGATGCTGGAGAGGATGTGG - Intronic
953111181 3:39940343-39940365 TAAAGATACTGGAAAGGAAAAGG + Intronic
953432578 3:42851892-42851914 CAAGAATTTGGGAAAGGAGCAGG - Intronic
959455901 3:106561556-106561578 GAGAGATACTGGAATGGAGCTGG - Intergenic
960726051 3:120671487-120671509 AAAAGATTCTGGAAAGGCTGTGG + Intronic
962880403 3:139571636-139571658 AAATGATTCTGGAAAGAACCTGG + Intronic
963043625 3:141086972-141086994 CACTGATTCTGCAGAGGAGCAGG + Intronic
963838625 3:150082073-150082095 CACAGTTTCTGGAAAGTAGGGGG - Intergenic
966345344 3:178973253-178973275 CAAAGGACCAGGAAAGGAGCAGG + Intergenic
966722220 3:183075287-183075309 CAACCATTGTGGAAAGCAGCAGG - Intronic
968456098 4:700804-700826 CAAGGACTCTGGAAAGAAGCTGG - Intergenic
969335307 4:6505029-6505051 GAAAAACTCTGGAAAGAAGCCGG + Intronic
970510022 4:16772529-16772551 TAAAGATTCTGGAAAGTTCCTGG - Intronic
970744011 4:19273510-19273532 TCCAGATTCTGCAAAGGAGCAGG - Intergenic
971130487 4:23803931-23803953 CCAAGAATCTGGTAAGGAGTAGG + Intronic
971468646 4:26994272-26994294 AAAAGATTGGGGAAACGAGCAGG - Intronic
971771603 4:30904424-30904446 CAAAGTTTCTTAAAAGGAGATGG - Intronic
972313458 4:37902356-37902378 CAAAGATGCTGGAATAGATCAGG - Exonic
973932113 4:55803553-55803575 GAAAGACTTTGGAAAGGAGCTGG + Intergenic
975491759 4:74996761-74996783 CACACAATCTGGAAAGGAGTGGG - Intronic
976534571 4:86196210-86196232 CAAAGATGCTGGAGAGGATGTGG - Intronic
976965823 4:91039337-91039359 TAAAGAATATGGAAATGAGCTGG - Intronic
977095215 4:92733897-92733919 CAAAAATTCTTCAGAGGAGCAGG + Intronic
977464175 4:97362354-97362376 AACAGATTCTGGAAAGGATGTGG - Intronic
977597588 4:98900740-98900762 CAAACCTACTGGAAAGGAGTGGG + Intronic
979138409 4:117140701-117140723 CAAAGATTCTGCACAGCAGAGGG + Intergenic
980070115 4:128234900-128234922 GTAAGATTCTGGGAAGGAGACGG + Intergenic
983209710 4:164946152-164946174 CAGAGACTCGGGGAAGGAGCAGG + Intergenic
984024530 4:174526995-174527017 CAAAGATACTCAAGAGGAGCGGG + Intergenic
984138413 4:175971282-175971304 AAAAAATTCTGAAAAGGACCCGG + Intronic
984342847 4:178481077-178481099 CAAAGGTTATAGAAAGCAGCTGG - Intergenic
985064643 4:186108505-186108527 CAAAGATGCTGAATAGCAGCAGG + Intronic
985111471 4:186551015-186551037 CAAATATTGTGGAAAGCAACAGG + Intronic
985383058 4:189415820-189415842 CACAGCATCTGGCAAGGAGCAGG - Intergenic
986768239 5:10947719-10947741 GGAAGATTCTGGAAGGAAGCAGG - Intergenic
989128113 5:38076355-38076377 GAAAGCTTCTGGAAAAGAGAAGG + Intergenic
989750751 5:44890183-44890205 CAAAGATTGAGAAAAGTAGCAGG - Intergenic
990292364 5:54365636-54365658 AACAGATGCTGGAAAGGATCTGG + Intergenic
993247859 5:85475013-85475035 CACAGATGCTGGAAAGGATGTGG + Intergenic
993929745 5:93923284-93923306 TAAGGATTCTGGAAAACAGCAGG + Intronic
994365755 5:98914976-98914998 GAAAGAATCTGGAAAGTAGTAGG + Intronic
995221897 5:109657439-109657461 CAAACTTTCAGGAAAGGAGAAGG - Intergenic
996093511 5:119374470-119374492 CAAAGATCCTGGGATGGAGAAGG + Intronic
996727601 5:126686463-126686485 CATTGATTCTGGAAAGAAACTGG + Intergenic
996899501 5:128528229-128528251 CATAGTTTCTGGAAAGCAGGAGG + Intronic
998165328 5:139839353-139839375 CAAAGGTTCTGGGCAGAAGCAGG - Intronic
999086000 5:148890430-148890452 AACAGATGCTGGAAAGGAGGTGG - Intergenic
999343699 5:150796173-150796195 CAGAGATTCTGGAATGGAGAAGG - Exonic
1000021359 5:157321975-157321997 AAAAGACACTGGAAAGGAGGAGG + Intronic
1004418406 6:15446195-15446217 CATAGATGCTGGAAAGGAGGAGG - Intronic
1004722077 6:18276699-18276721 CTCAGGTTCTGGAAAGAAGCAGG - Intergenic
1005364538 6:25063967-25063989 CAGAGGTTGTGGAAAGTAGCAGG + Intergenic
1006084790 6:31587944-31587966 TAAAGAGGCTGGAGAGGAGCTGG + Exonic
1006321104 6:33320080-33320102 CACAGATTCTGAAGAGGAGGAGG - Exonic
1007658694 6:43468960-43468982 CACAGATTGTGGGCAGGAGCAGG + Intergenic
1008217438 6:48810544-48810566 AAGAGATTCTGGAGAGGGGCAGG + Intergenic
1010024262 6:71197446-71197468 CAAGGATACTGAAAAGGAGAAGG + Intergenic
1010455330 6:76048171-76048193 CAAAGATTCAGGTAAGGGGTAGG - Intronic
1011592361 6:88982434-88982456 CCAAGGCTCTGCAAAGGAGCGGG + Intergenic
1012688286 6:102280446-102280468 CAATCATTATGGAAAGAAGCTGG - Intergenic
1013421223 6:109968730-109968752 AAAAGGTTCTGGAAGGGGGCAGG - Intergenic
1013871706 6:114770395-114770417 CAAAGAATCTTGAAAGCAGTGGG + Intergenic
1016938174 6:149463896-149463918 CAGGAATTCTGGAAAGGAACAGG + Intronic
1017602618 6:156100250-156100272 CAATGAGTATGGAAAGGAGGGGG - Intergenic
1018149907 6:160927695-160927717 CAAAGGTTCTGGAAAGGACTGGG - Intergenic
1018565821 6:165151601-165151623 GAAAGACACTGGAAAGGAGCAGG - Intergenic
1019006849 6:168805339-168805361 CTAAGAGTCTGAAATGGAGCAGG + Intergenic
1020957691 7:14762205-14762227 CAAACATTCTTGGAATGAGCTGG + Intronic
1022111988 7:27237474-27237496 GAACATTTCTGGAAAGGAGCAGG - Intergenic
1022375608 7:29807856-29807878 AAAAGATTCTGGAAAGGAGGAGG - Intronic
1022653371 7:32297331-32297353 CAAAGATTTTGAAAATGAGGGGG - Intronic
1023203550 7:37723880-37723902 CAAAATTTCTGGTAAGGAGATGG + Intronic
1023495164 7:40787713-40787735 CAAAGAACCAGGAAAGGGGCAGG + Intronic
1023708455 7:42966839-42966861 CAAAAATTCAGGAAAGGAGAAGG - Intergenic
1024023862 7:45394853-45394875 GAAAGATACTAGAAAGGAACTGG - Intergenic
1024559160 7:50628807-50628829 CATAAATTCTGGAAAAGAGATGG - Intronic
1024872322 7:53979847-53979869 CTAAGCTTCTGGAAAGGGGAAGG - Intergenic
1025635861 7:63318409-63318431 CAAAGCTCCTGGAGAGCAGCAGG - Intergenic
1025646835 7:63429771-63429793 CAAAGCTCCTGGAGAGCAGCAGG + Intergenic
1026285510 7:68959311-68959333 GAAAGAATCAGGAAAGGGGCCGG + Intergenic
1026475198 7:70729149-70729171 CAAAGGCTCTGGAAAGCACCAGG - Intronic
1026491775 7:70869810-70869832 CAAGGGTCCTGGGAAGGAGCTGG - Intergenic
1028035537 7:85976924-85976946 CATAGATTCTAGAAAAGACCAGG - Intergenic
1028424689 7:90673306-90673328 CAAAGATTGGGGAAAGAAGAGGG + Intronic
1029356767 7:100057838-100057860 CCAAGAGTCTGGTGAGGAGCAGG + Exonic
1030763390 7:113378966-113378988 GAAATATTCTTGAAAGGATCTGG + Intergenic
1031428107 7:121632457-121632479 CAAATATTCTCTAAAGCAGCAGG + Intergenic
1033195048 7:139320551-139320573 CAAAAATTCTGGCAAAGTGCTGG + Intergenic
1033478609 7:141715954-141715976 CCAAGATTCTGGGAACGAGTAGG - Intronic
1036394093 8:8351980-8352002 CAAAGATTCTGGTCAGGCACAGG - Intronic
1036805617 8:11830613-11830635 AGAAGGTTCTGAAAAGGAGCAGG - Intronic
1037017143 8:13922945-13922967 CAAAAAGTCTGGAAAGAAGCTGG - Intergenic
1037429663 8:18796410-18796432 CAAAGAGTATGGAAAGGAGGAGG + Intronic
1037546589 8:19929857-19929879 CATAGTTTTTGGAAAGGGGCAGG + Intronic
1037913508 8:22758326-22758348 CAAACTTTCTGGAAAGGCCCAGG + Intronic
1038182839 8:25245000-25245022 AAAAGATTCTGGAAAAGATAAGG - Intronic
1039160504 8:34613134-34613156 CAGAGATTTTGGAAAGAAACAGG - Intergenic
1039554293 8:38465984-38466006 GAAAGAGGCTGGAAAGAAGCGGG + Intronic
1040970464 8:53130937-53130959 CACAGATTCTAGAAAGAACCTGG - Intergenic
1041139871 8:54805932-54805954 CAAACATTCTGCAAAAGAGAAGG - Intergenic
1041503181 8:58561442-58561464 CAAAGAATTTTGAAAGCAGCAGG + Intronic
1042566365 8:70116253-70116275 TAACAATTCTGGAAAAGAGCAGG + Intronic
1042796524 8:72669181-72669203 CAGTAATTCTGGAAAGGAGCTGG - Intronic
1044418104 8:91959209-91959231 GAAAAATTTTGGAAAGGGGCTGG + Intronic
1044727009 8:95202227-95202249 CAAAGAAAATGGAAAGGGGCTGG + Intergenic
1045436293 8:102168251-102168273 CAACAATTGTGGAAGGGAGCGGG + Intergenic
1046565004 8:115887616-115887638 CAAAGATTCTGGAAATTATGGGG - Intergenic
1047905108 8:129464572-129464594 CAAAAAGTATGGAAAGAAGCTGG + Intergenic
1047982961 8:130202433-130202455 CACAGATTCTGGAACAGAGTGGG + Intronic
1048534700 8:135282350-135282372 CAGAGATTCTGTGAAGGAGATGG - Intergenic
1048622544 8:136150450-136150472 CAAAAATTTTGGAAAGGTGTTGG + Intergenic
1052487756 9:29124760-29124782 AAAAGATGCTGGAAAGGATGTGG + Intergenic
1053398326 9:37795871-37795893 CAAGGCTTCTGAAAAAGAGCAGG + Intronic
1053586313 9:39462907-39462929 AGAAGATTCTAGAAAGGAGCAGG - Intergenic
1054579991 9:66902322-66902344 AGAAGATTCTAGAAAGGAGCAGG + Intronic
1055058063 9:72041623-72041645 AAAAGACAATGGAAAGGAGCAGG - Intergenic
1055562722 9:77536727-77536749 CAAAGATGATAGAAAGTAGCAGG - Intronic
1055657836 9:78469812-78469834 CCATGATTATGAAAAGGAGCAGG + Intergenic
1057307584 9:93921118-93921140 CAAGGATTCTGGGGAGCAGCGGG + Intergenic
1059114235 9:111586508-111586530 CAACGATTCTGGAAAGTGGAAGG - Intronic
1059393725 9:114017466-114017488 CAAATATCCAGAAAAGGAGCTGG - Intronic
1059671428 9:116496031-116496053 CAAGGATTTGGGAAAGGAGAGGG - Intronic
1059904945 9:118972103-118972125 TAAACATTCTGCAAAAGAGCTGG + Intergenic
1060267377 9:122120251-122120273 AGAAGATTCTGGAGAGGAGGGGG - Intergenic
1061222837 9:129262245-129262267 CATTGATTCTGGACAGGACCAGG - Intergenic
1061341799 9:129988191-129988213 CATAGTTTCTGGAAAGGGACTGG + Intronic
1061701374 9:132418470-132418492 CAAAGACTCTAGAAATGAGCCGG + Intronic
1062157537 9:135061487-135061509 CACAGATTCAGGAGAAGAGCTGG - Intergenic
1062238885 9:135525528-135525550 CAAAGATTCAGCAAAGTGGCAGG + Intronic
1062477309 9:136735127-136735149 CAAAGGTTCTGGCATGGGGCTGG - Intergenic
1186351519 X:8744574-8744596 CAATGACTCTGGAAAAGAGTCGG + Intergenic
1187160227 X:16758012-16758034 CATTGCTTCTGGGAAGGAGCAGG + Intronic
1187362713 X:18643076-18643098 GGAAGATTCTGGAAAGGGGAGGG + Intronic
1187755613 X:22522507-22522529 CAAAGACACTGGAAATGAGTTGG + Intergenic
1188110823 X:26194419-26194441 CAAAGATGCTGTAAAGAAGAAGG + Exonic
1188145404 X:26605958-26605980 CAATGATTCTGGTAAGGAAATGG - Intergenic
1190114627 X:47618715-47618737 CAAAGCTTTTGGAGAGAAGCTGG + Intronic
1190367023 X:49704881-49704903 GAGAAATTCTGGAAGGGAGCTGG - Intergenic
1191833158 X:65436642-65436664 CCAAGAATCTTGAAAGCAGCAGG - Intronic
1192776295 X:74249108-74249130 CTCAGTTTCTGGAAAGGAGGAGG - Intergenic
1193244777 X:79214977-79214999 AAAAGATTCTGGAGAGGATGTGG - Intergenic
1194747216 X:97641187-97641209 GCAAGATACTGGAAAGGAGAGGG + Intergenic
1195576645 X:106459193-106459215 CAAGGCCTCTGGATAGGAGCTGG - Intergenic
1196967860 X:121077761-121077783 CATAGATTCTGGAACAGATCAGG - Intergenic
1198176445 X:134160318-134160340 CAAGGATTCTGGAAGGTAGGAGG - Intergenic
1200316074 X:155134499-155134521 CAAACATCCTGGAATGGATCTGG + Intronic
1201361528 Y:13156194-13156216 TAAAGATTCAGGAAAAGTGCAGG - Intergenic
1201562401 Y:15332104-15332126 CACATGTTGTGGAAAGGAGCTGG + Intergenic