ID: 900795957

View in Genome Browser
Species Human (GRCh38)
Location 1:4708562-4708584
Sequence CCTTGGGCGGCTCTGAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900795957_900795964 11 Left 900795957 1:4708562-4708584 CCTCATCTCAGAGCCGCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 198
Right 900795964 1:4708596-4708618 AGATTGTTTGTACTGCTCACTGG 0: 1
1: 0
2: 0
3: 3
4: 93
900795957_900795965 18 Left 900795957 1:4708562-4708584 CCTCATCTCAGAGCCGCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 198
Right 900795965 1:4708603-4708625 TTGTACTGCTCACTGGTCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900795957 Original CRISPR CCTTGGGCGGCTCTGAGATG AGG (reversed) Intronic
900031866 1:378388-378410 CCTTGGGCAGCCCTGATCTGGGG - Intergenic
900052414 1:606579-606601 CCTTGGGCAGCCCTGATCTGGGG - Intergenic
900108741 1:996933-996955 CCGAGGGGGGCTCTGAGAAGGGG + Intergenic
900230868 1:1556680-1556702 CCTTGTGTGGCTCTGTGTTGAGG - Intronic
900285202 1:1895728-1895750 CCTTGGGGGCCTCTGAGAGGAGG + Intergenic
900569434 1:3351128-3351150 GCTTGTGGGTCTCTGAGATGTGG + Intronic
900634692 1:3657228-3657250 CCCTCGGAGGCTCTGAGAGGGGG + Intronic
900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG + Intergenic
900795957 1:4708562-4708584 CCTTGGGCGGCTCTGAGATGAGG - Intronic
901653396 1:10755759-10755781 CCTTGGGCTGGGCAGAGATGTGG - Intronic
902146479 1:14405138-14405160 CCTTGGTCTGCTCTGAGCAGTGG - Intergenic
907277842 1:53326981-53327003 CCTTGGCCGGCCCTGCGAGGGGG + Exonic
907404180 1:54243665-54243687 CATTGAGAGGCTCTGAGGTGAGG + Intronic
907625071 1:56021981-56022003 TCTTGGGCAGCTCTGTCATGTGG + Intergenic
907850374 1:58249840-58249862 ACTTGGGCGGCTCTGTGCGGCGG + Intronic
909489261 1:76208136-76208158 TCTTGGTAGGCCCTGAGATGAGG - Intronic
911340966 1:96635771-96635793 CCTTGGGCAGCTTTGAGTTATGG + Intergenic
912488982 1:110050815-110050837 CCTGGGGCTGCTCTGAGAGCAGG + Intronic
914440356 1:147700250-147700272 CCTTGGGCAGCTGGGAGAGGTGG + Intergenic
917241475 1:172953527-172953549 CCTTGGGCAACTCTGAGCTTTGG + Intergenic
918143839 1:181738944-181738966 CCCTGGGTGACTATGAGATGGGG + Intronic
918244078 1:182643735-182643757 CCTTGGGCACCTCTGGGGTGAGG - Intergenic
923059807 1:230460836-230460858 CCTGGGGCCGTTCTGGGATGTGG + Intergenic
924250041 1:242123571-242123593 ACTTGCACAGCTCTGAGATGTGG + Intronic
924829194 1:247574520-247574542 CCTTAGGCAACTCTGATATGTGG + Exonic
1063154777 10:3369073-3369095 CCTCTGGAAGCTCTGAGATGGGG - Intergenic
1064138008 10:12767019-12767041 CCTTCAGCGGGTCTGAGATGGGG - Intronic
1065662397 10:28019579-28019601 ACTTGGGAGGCTCTGACAGGAGG - Intergenic
1068891532 10:62153503-62153525 CCTTGGGTTGTTCTGAGAAGGGG - Intergenic
1069854870 10:71434579-71434601 GCTGGGGAGGCTCTGAGAGGTGG - Intronic
1070825284 10:79387107-79387129 ACTGGGCCGGCCCTGAGATGTGG - Intronic
1071746435 10:88424862-88424884 CTTTGTGCTGCTCTGAGATTTGG + Intronic
1071958700 10:90786843-90786865 CCTTGGGCACCTCTTACATGGGG - Intronic
1075447319 10:122522222-122522244 CCTTGGGCTTCTCTTTGATGAGG - Intergenic
1076935977 10:133567754-133567776 CTTTGGGCGGCTCTGGAGTGTGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1079568749 11:21916345-21916367 CCTTGGGCAGCTCTGCCCTGTGG - Intergenic
1079721190 11:23816696-23816718 CCTTGGGCAGCTCTGCCCTGTGG + Intergenic
1084555999 11:69876184-69876206 GCTTGGGAGGCTCTGGGATCTGG - Intergenic
1084880765 11:72169912-72169934 CCTAGGGCAGCTGTGAGAAGAGG + Intergenic
1091287322 11:134414858-134414880 CTTTGGGGGCCTCTGAGAAGAGG - Intergenic
1095457196 12:42400616-42400638 CTTTGGGAGGCTCAGAGAGGAGG - Intronic
1096793262 12:54058306-54058328 GCTTGGGAGGGTCAGAGATGGGG - Intergenic
1097173184 12:57128648-57128670 CCGGAGGCGGCTCCGAGATGGGG + Exonic
1099663435 12:85596274-85596296 CCTTGGGCAGCTCTGCCCTGTGG + Intergenic
1104633477 12:130424149-130424171 CCTTGTGCGACTCTGGGAGGTGG + Intronic
1104917248 12:132272086-132272108 TCTGGGGCTGCTCTGAGTTGGGG - Intronic
1105072244 12:133241694-133241716 GCTTGGGCGGCTCAGAGCTTGGG + Intergenic
1105264413 13:18803409-18803431 CCTTGGGCAGATCTGACCTGTGG + Intergenic
1107635776 13:42390811-42390833 CCTAAGGCAGCTCTGGGATGGGG - Intergenic
1111051163 13:82884380-82884402 CCTAGGGCAGCTGTGAGAAGGGG - Intergenic
1113413029 13:110107029-110107051 CCTGGGAGGTCTCTGAGATGAGG - Intergenic
1115140758 14:30168588-30168610 CCTTGGGCAGCTCTGCCCTGTGG + Intronic
1117881208 14:60315397-60315419 GCCTGGGAGGCTCTGGGATGGGG - Intergenic
1121001350 14:90454030-90454052 TCTTGTGCGGCTCTGGGCTGAGG + Intergenic
1122806820 14:104264052-104264074 CCTCGAGGGGCTCTGAGTTGGGG + Intergenic
1131179411 15:90229795-90229817 TGTGGGGCGGCTCTGAGGTGGGG + Intergenic
1132168236 15:99619148-99619170 CCTTTGGCAGCAGTGAGATGAGG + Intronic
1132407802 15:101554823-101554845 CCGTTGGCGTCTCTGAGAGGAGG + Intergenic
1132415480 15:101615867-101615889 CCCTGGGAGGGTCTGAGCTGTGG - Intergenic
1136291264 16:29272938-29272960 ACTTGGCTTGCTCTGAGATGGGG - Intergenic
1138128906 16:54462000-54462022 GCTGGGGCAGCTCTGGGATGAGG + Intergenic
1138394192 16:56691567-56691589 CCTTTGGGAACTCTGAGATGTGG + Intronic
1140198871 16:72878520-72878542 CCTCGGGTTGCTCTGAGAAGTGG - Intronic
1141039669 16:80662209-80662231 CCTTGGGTGTCTTTGAGAGGTGG - Intronic
1142097136 16:88246404-88246426 ACTTGGCTTGCTCTGAGATGGGG - Intergenic
1142130586 16:88429996-88430018 CGTTGAGCGCCTCTGTGATGAGG - Exonic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1144568683 17:16381208-16381230 CCTTGGGGGGGTGTGAGAGGGGG + Intronic
1145083379 17:19914405-19914427 CTTTGGGAGGCTGAGAGATGTGG + Intronic
1145116263 17:20213336-20213358 CTTTGGGAGGCACTGAGGTGTGG - Intronic
1145217337 17:21061818-21061840 CATTGGCTGCCTCTGAGATGGGG + Intergenic
1145251036 17:21297177-21297199 CGGTGCGTGGCTCTGAGATGGGG + Intronic
1147037328 17:37691507-37691529 CCCTGAGCGGCTCTGAGTTTGGG - Intronic
1148741760 17:49897176-49897198 CCTTGGGTGGGTTTGAGATTTGG + Intergenic
1149657283 17:58316822-58316844 GCCTGGGCCCCTCTGAGATGAGG - Intronic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1151686334 17:75648981-75649003 CCATGGCCGGCTCTGGGACGGGG + Intronic
1151944317 17:77311232-77311254 CCTAGGGAGGCTCTGGGGTGGGG - Intronic
1152530603 17:80916498-80916520 CCTTTGGCAGGTGTGAGATGCGG + Intronic
1152947790 17:83207326-83207348 CCTTGGGCAGCCCTGATCTGGGG + Intergenic
1154423980 18:14258152-14258174 CCTTGGGCAGATCTGACCTGTGG - Intergenic
1156784460 18:40893343-40893365 CCTTGGGCAGCTCTGTCGTGTGG - Intergenic
1159054297 18:63449538-63449560 CCTTGGGTGTTTTTGAGATGGGG - Intergenic
1159265331 18:66072405-66072427 CCTTGGGCAGCTCTGCACTGTGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460912 18:79037412-79037434 CCTTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160540266 18:79617244-79617266 GCTTGGGGGGCTCTGAGTGGGGG - Intergenic
1160754750 19:751448-751470 CCTTGGAGGGCTCTGGGATTTGG - Intronic
1160873965 19:1288753-1288775 CCTTGGGCCGCTATAAGGTGGGG + Intronic
1160911210 19:1474584-1474606 CCTCGGGCTGCTCTGACATTGGG + Exonic
1162510806 19:11116982-11117004 CCTTGGCCGTCTTTGAGGTGTGG + Exonic
1162518434 19:11164591-11164613 CTTTGGGCAGCTTTGAGAAGCGG - Intronic
1166998413 19:46730822-46730844 GCTTGGGCGGCTCAGTGCTGGGG - Exonic
925855046 2:8121432-8121454 CCTGGGTGGGCTCTGAGGTGAGG - Intergenic
926479805 2:13377830-13377852 CCTTTCACGGCTCTGAGATTAGG - Intergenic
928853873 2:35781512-35781534 CCTAGGGGGGCTGTGAGAAGAGG + Intergenic
929803456 2:45124102-45124124 CCTTGGGGTGCTCTGATATTTGG - Intergenic
932752298 2:74379112-74379134 CCTTGGGCAGCTCTTAGCTTCGG + Intronic
932819583 2:74887993-74888015 TCTTGAGCCGCTCTGAGATGCGG - Exonic
933025511 2:77252744-77252766 CGTTGCGTGCCTCTGAGATGGGG + Intronic
933215648 2:79626828-79626850 TCTTGGAGGGGTCTGAGATGAGG + Intronic
935155924 2:100483530-100483552 CCCTAGGTGGCTTTGAGATGGGG + Intergenic
937872750 2:126797805-126797827 CCTTGGCCAGCTCTCAGAGGGGG + Intergenic
938764033 2:134448664-134448686 CCTTGGCCAGCTCTGAGCTTTGG - Exonic
941866207 2:170337232-170337254 CCTTGGGGTGGTCTGAAATGTGG - Intronic
945428385 2:209735993-209736015 CCATGGGTACCTCTGAGATGGGG + Intergenic
946534072 2:220607626-220607648 CCTTGGGCAGCTCTGCCCTGGGG + Intergenic
947320021 2:228906849-228906871 CCTTGGGAGGCTGAGACATGAGG - Intronic
947855133 2:233318847-233318869 CTCTGGGCGGCTCTGGGAAGGGG + Intronic
949002568 2:241624791-241624813 TCTTGGGGGGCTCCCAGATGAGG - Intronic
1171432024 20:25088998-25089020 CCTGGGGAGGCTCTGCGGTGAGG - Intergenic
1172032096 20:31989420-31989442 CCTTGGAAGGCTTTGAGAAGGGG + Intronic
1172609658 20:36240486-36240508 GCGTGGGCAGCTCTGAGAAGCGG - Exonic
1172628277 20:36361078-36361100 CCTTTGCTGGCTCTGAGATGTGG - Intronic
1174040774 20:47697822-47697844 TATCGGGCTGCTCTGAGATGAGG + Intronic
1174674925 20:52344576-52344598 CCATGGGAGGCTTTGAGAAGAGG + Intergenic
1175922812 20:62458019-62458041 CCTGGGGCGGCACTGAAAGGAGG + Intergenic
1176413053 21:6459131-6459153 CCTTGGGGGTCTCTGTGAAGGGG + Intergenic
1176849489 21:13901851-13901873 CCTTGGGCAGATCTGACCTGTGG + Intergenic
1179065165 21:38017976-38017998 CCTTGTGCAGCTGTGAGAAGAGG + Intronic
1179688548 21:43067453-43067475 CCTTGGGGGTCTCTGTGAAGGGG + Intronic
1180934022 22:19612137-19612159 CCTCGGGGGCCTCTGGGATGTGG - Intergenic
1181044141 22:20206723-20206745 CATGGGTGGGCTCTGAGATGTGG + Intergenic
1182121553 22:27790487-27790509 CCCTGGGTGGCTCTGAGCTGGGG + Intronic
1182502040 22:30754858-30754880 CAATGGGAGGCTTTGAGATGGGG - Intronic
1185242045 22:49751912-49751934 TCTGGGGGGGCTCTGGGATGTGG - Intergenic
1185372155 22:50465911-50465933 CCTTGGGGGCCTTTGGGATGTGG - Intronic
950887646 3:16375144-16375166 CCTTAGGGGGCTCTGAGAGAAGG + Intronic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
955574987 3:60351341-60351363 TATTGGGCTGCTGTGAGATGAGG - Intronic
959505534 3:107152577-107152599 CTGTGGGGGGCTCTGAGATTGGG - Intergenic
960509524 3:118531649-118531671 CTTGGGGTGGCTCTGAGATGGGG - Intergenic
961222816 3:125213075-125213097 CCCTGTGCGGCTCTGAGGAGTGG + Intergenic
961787753 3:129357848-129357870 CCTCGGAAGGCTCTGAGATACGG + Intergenic
962256803 3:133876358-133876380 CCTTGGGAGGGTCAGAGATCTGG - Intronic
964966144 3:162495960-162495982 CCTAGTGGGGCTCTGAGAAGAGG - Intergenic
966388298 3:179425278-179425300 CGTGGGGAGGCTCTGAGAGGAGG - Intronic
967406248 3:189119082-189119104 CCTTGGGCAGCTCTGCCCTGTGG - Intronic
968295166 3:197570850-197570872 CCTAGTGCGGCTGTGAGAGGAGG + Intronic
968504429 4:965373-965395 CCTTGGGCAGCCCTGGGCTGGGG - Intronic
969393428 4:6906114-6906136 CCCTTGGTGGCTCTGAGCTGGGG + Intergenic
971893900 4:32564273-32564295 CCTTGGGAAACTCTGAGGTGTGG + Intergenic
975307399 4:72865692-72865714 CCTTGGGCAGCTCTGCCTTGTGG - Intergenic
975783202 4:77860970-77860992 CCTTGGGAGGCTGAGACATGAGG + Intergenic
984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG + Intronic
985757707 5:1729087-1729109 CCTCCGGCGGGTCTGAGATCCGG - Intergenic
986493752 5:8320635-8320657 CCTTGGGCTGCTCTGCTCTGGGG - Intergenic
987042284 5:14074292-14074314 CCTTGGCCTCCCCTGAGATGGGG - Intergenic
987470495 5:18321706-18321728 CCTTGGCCTGCTCTGAGGTATGG + Intergenic
992215898 5:74524391-74524413 CATTGGGCAGCTCTGCCATGTGG - Intergenic
994979937 5:106861009-106861031 CCTAGTTAGGCTCTGAGATGTGG - Intergenic
995723808 5:115165236-115165258 CCTAGGGGAGCTCTGAGAAGAGG - Intronic
996416139 5:123212623-123212645 CCATGGGTGGCCCTGAGATGGGG - Intergenic
997597085 5:135114216-135114238 CCTTGAGGGGCTGTGAGAAGGGG + Intronic
998531689 5:142890896-142890918 ACTTGGGCAGCTCTCTGATGTGG + Intronic
1000026589 5:157363976-157363998 CCCTGAGAGGCTCTGAAATGGGG + Intronic
1000957960 5:167564428-167564450 ACTTGGGCTCCTCTGAGATAAGG + Intronic
1000978094 5:167786816-167786838 GTTTGGGGAGCTCTGAGATGTGG - Intronic
1002047660 5:176550845-176550867 CCGTGGACTGCTCTGAGATGCGG + Intronic
1002741954 5:181440480-181440502 CCTTGGGCAGCCCTGATCTGGGG + Intergenic
1003472648 6:6451622-6451644 CCTTGGGGTGCACTTAGATGGGG + Intergenic
1003617414 6:7668224-7668246 CCTTCGGCGGGTCAGAGAAGTGG - Intergenic
1005831259 6:29672874-29672896 AGTTGGGCGGCTCTGTGAGGTGG + Exonic
1006117223 6:31781756-31781778 CCTTTGGCCTCTCTCAGATGAGG - Exonic
1006756401 6:36419428-36419450 CCTTGGGCAGCTCAGTGATCAGG + Intronic
1007026091 6:38576252-38576274 CCCTAGGCAGCTCTGAGATATGG + Intronic
1007377991 6:41469438-41469460 CCTTGGGGGTCTCTGGGGTGGGG - Intergenic
1007746917 6:44048641-44048663 CCCTGGGCAGCCATGAGATGGGG + Intergenic
1012450717 6:99350015-99350037 CCTGGGGCGGCGCGGAGCTGCGG + Intronic
1014708551 6:124779129-124779151 ACTTGGGAGGTTTTGAGATGTGG + Intronic
1017545018 6:155441253-155441275 ATTTGGGCGGCTTTGAGATCTGG + Intronic
1018935353 6:168270701-168270723 ACTCGGGAGGCTGTGAGATGGGG - Intergenic
1019247095 6:170716237-170716259 CCTTGGGCAGCCCTGATCTGGGG + Intergenic
1019574192 7:1728399-1728421 TCTTGATAGGCTCTGAGATGCGG + Intronic
1022595926 7:31713377-31713399 CCTTGGGCAGCTCTGCCCTGTGG + Intergenic
1023394743 7:39742481-39742503 CCTTGGAGGGCGCTGAGACGTGG + Intergenic
1024479372 7:49848279-49848301 CCGTGGGAGGCTCTGAGTGGAGG - Intronic
1025929311 7:65981868-65981890 CCCTGGGCGTCTCCGAGCTGGGG - Intronic
1026687089 7:72520343-72520365 CCTTTGGTAGATCTGAGATGAGG + Intergenic
1026687313 7:72522308-72522330 CCTTTGGTAGATCTGAGATGAGG - Intergenic
1030512809 7:110505380-110505402 CCTTGGACAGTTCAGAGATGTGG + Intergenic
1030907298 7:115202604-115202626 CATTGGATGGCTTTGAGATGAGG - Intergenic
1031429569 7:121650745-121650767 CCTTGGGCAGCTCTGCCCTGTGG - Intergenic
1032414556 7:131726169-131726191 CAGGGGGTGGCTCTGAGATGAGG + Intergenic
1032414754 7:131727419-131727441 CAAGGGGTGGCTCTGAGATGAGG - Intergenic
1032925880 7:136604095-136604117 CCTAGTGGGGCTGTGAGATGAGG + Intergenic
1035344925 7:158191676-158191698 TCTTGGGTGGCTCTGTGATGCGG + Intronic
1035501046 8:91716-91738 CCTTGGGCAGCCCTGATCTGGGG - Intergenic
1036757901 8:11483503-11483525 CATTTGGCAGCACTGAGATGGGG - Intergenic
1037893460 8:22636446-22636468 CCTTGGGGGGCTGAGAGAGGAGG + Intronic
1045676785 8:104615791-104615813 CCTTGGGAGGCTCAGATAGGAGG + Intronic
1046473986 8:114716391-114716413 CTTTGGGAGGCTGTGGGATGGGG + Intergenic
1049584209 8:143425496-143425518 CCTGGGGCAGCTCAGATATGTGG - Intronic
1049687877 8:143946200-143946222 CCTGGGGCAGCTCCGAGAGGGGG + Intronic
1051068386 9:13132446-13132468 CCTTGGGAGGTTCTGAGTAGGGG + Intronic
1057890405 9:98865584-98865606 CCTTGGAAGTCTGTGAGATGGGG - Intergenic
1059423555 9:114207068-114207090 CCTAAGGCGGATCTGGGATGGGG + Intronic
1061330759 9:129890707-129890729 CACAGGGCGGGTCTGAGATGAGG + Intronic
1061927252 9:133812006-133812028 CCTTCGGTGGCTCAGACATGGGG + Intronic
1203607866 Un_KI270748v1:71696-71718 CCTTGGGCAGCCCTGATCTGGGG + Intergenic
1187193710 X:17060665-17060687 GCTGGGGAGGCTCTGAGAGGGGG + Intronic
1190565502 X:51726541-51726563 CTTTGGTCAGCTCTGAGATATGG + Intergenic
1192534155 X:71913142-71913164 CCTTGGGTGCCTCTGAGCCGTGG - Intergenic
1193360221 X:80572275-80572297 TCTTGAGTAGCTCTGAGATGTGG + Intergenic
1193492079 X:82162440-82162462 CCTAGGGGGGCTGTGAGAAGAGG + Intergenic
1200067999 X:153514204-153514226 CCTTGGCCAGCTCTGAAGTGAGG - Intergenic