ID: 900796660

View in Genome Browser
Species Human (GRCh38)
Location 1:4712296-4712318
Sequence CGGTGGGGCCCCGGAGCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 269}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900796646_900796660 16 Left 900796646 1:4712257-4712279 CCTCGCCTCTTCGTCCTCGTCCT 0: 1
1: 0
2: 2
3: 170
4: 1062
Right 900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 269
900796652_900796660 -4 Left 900796652 1:4712277-4712299 CCTCGTCCTCCGCGGTGGCCGGT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 269
900796643_900796660 22 Left 900796643 1:4712251-4712273 CCCTTCCCTCGCCTCTTCGTCCT 0: 1
1: 0
2: 4
3: 57
4: 719
Right 900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 269
900796656_900796660 -10 Left 900796656 1:4712283-4712305 CCTCCGCGGTGGCCGGTGGGGCC 0: 1
1: 0
2: 1
3: 22
4: 149
Right 900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 269
900796642_900796660 26 Left 900796642 1:4712247-4712269 CCAGCCCTTCCCTCGCCTCTTCG 0: 1
1: 0
2: 2
3: 25
4: 619
Right 900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 269
900796644_900796660 21 Left 900796644 1:4712252-4712274 CCTTCCCTCGCCTCTTCGTCCTC 0: 1
1: 0
2: 6
3: 99
4: 980
Right 900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 269
900796647_900796660 11 Left 900796647 1:4712262-4712284 CCTCTTCGTCCTCGTCCTCGTCC 0: 1
1: 5
2: 36
3: 901
4: 6170
Right 900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 269
900796645_900796660 17 Left 900796645 1:4712256-4712278 CCCTCGCCTCTTCGTCCTCGTCC 0: 1
1: 0
2: 1
3: 142
4: 1625
Right 900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 269
900796649_900796660 2 Left 900796649 1:4712271-4712293 CCTCGTCCTCGTCCTCCGCGGTG 0: 1
1: 0
2: 3
3: 23
4: 197
Right 900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900796660 Original CRISPR CGGTGGGGCCCCGGAGCAGC AGG Exonic
900349601 1:2228316-2228338 CCGAGGGGCCCGGGAGGAGCGGG - Intergenic
900584020 1:3423774-3423796 CGGGGGGGCCTGGTAGCAGCTGG - Intronic
900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG + Exonic
901696722 1:11013048-11013070 GGGTGGGGCGCAGGAGCACCAGG - Intronic
902067519 1:13700393-13700415 CGCTGGGGACCCGGCGCCGCAGG + Intronic
902940005 1:19794092-19794114 TGGTGGGGTCCAGGAGCTGCAGG - Intronic
903016352 1:20364672-20364694 AGATGGGGCCCTAGAGCAGCAGG + Intergenic
903191548 1:21659352-21659374 GGGTGGGGACCCGGAGCCGCCGG + Intronic
903370992 1:22836102-22836124 CTGTGGGGCCCCCGAGCCCCTGG - Intronic
903398388 1:23019910-23019932 CGGAGGGGCGTCGGACCAGCCGG + Exonic
903672751 1:25046187-25046209 GGGTGGGGCCCGGGAGGTGCAGG + Intergenic
904607745 1:31707223-31707245 TGGTGGGGCCCCAAGGCAGCAGG - Intergenic
904753448 1:32755011-32755033 CGGAGGGATCCCGCAGCAGCCGG - Intronic
907108936 1:51908996-51909018 GGCTGGGGCCCAGGAGGAGCAGG - Exonic
907278866 1:53332035-53332057 CCGTGGGGGCCCAGAGGAGCAGG - Intergenic
908702217 1:66913895-66913917 CGGTGTGAACCCGGAGCAGGCGG + Intronic
910238731 1:85063313-85063335 TGGTGTGGACCAGGAGCAGCAGG + Intronic
910251314 1:85201326-85201348 CGGAGGGCACCCGGAGCAGTTGG - Intergenic
914022822 1:143885084-143885106 CGCCGGGGCCCGGGAGCAGGCGG - Intergenic
915165677 1:153946582-153946604 CGCTGGGTCCCCGGCGCCGCGGG - Exonic
915279993 1:154815888-154815910 CGGTGGGACCCCAAAGCACCTGG + Intronic
919086903 1:192931179-192931201 AGTTTGGGCCCTGGAGCAGCAGG - Intergenic
919465369 1:197918071-197918093 CGGTGGAGAACCGGAGCGGCGGG + Intronic
920278635 1:204827185-204827207 CGGTGGTGTCCCAGAGCTGCAGG - Intergenic
920379567 1:205527805-205527827 AGGCGAGGCCCCGGAGCAGCTGG - Exonic
920400067 1:205670797-205670819 GGGTGGGGGCCAGCAGCAGCTGG - Intronic
921051664 1:211515626-211515648 CGGCGGGGCCACCGAGCGGCGGG + Intergenic
922696233 1:227732328-227732350 TGGAAGGGCCCCGGAGCAGGAGG + Exonic
922925128 1:229342153-229342175 GCGCGGGGCCCCGGAGGAGCAGG - Exonic
923017373 1:230137239-230137261 TGCTGGAGCCCCAGAGCAGCGGG - Intronic
923092006 1:230747899-230747921 CGGTGGGGACCCGGGGCATCTGG + Intronic
924581683 1:245329415-245329437 GGGTGGAGCTCCGGAGCTGCAGG - Intronic
1066987007 10:42476345-42476367 CGCTGGAGCCCGGGAGCGGCAGG + Intergenic
1067229133 10:44394826-44394848 TGGTGGGGCACCAGAGCACCTGG + Intergenic
1069651633 10:70053521-70053543 TGGAGGGGGCGCGGAGCAGCCGG + Intronic
1069738447 10:70672629-70672651 CGCAGGGGACCCGGAGCAGGCGG + Intergenic
1069870580 10:71530361-71530383 CAGTGGGGCCTCTCAGCAGCCGG + Intronic
1073342836 10:102758712-102758734 CGGTAGTGGCCCCGAGCAGCTGG + Intronic
1074158435 10:110817812-110817834 CGCTGGAGCCCTGGAGCTGCTGG - Intronic
1076165882 10:128282186-128282208 GCGTGTGGCCCAGGAGCAGCAGG - Intergenic
1076509469 10:131002085-131002107 CTGTTGGGCCCCAGAGCATCAGG - Intergenic
1076717741 10:132374925-132374947 TGCAGGGGCCCCGGGGCAGCGGG + Intronic
1077022226 11:422480-422502 CTGTGGGGACAGGGAGCAGCTGG + Intronic
1077052939 11:575927-575949 GGGCGGGGCTGCGGAGCAGCGGG + Intergenic
1077225251 11:1436706-1436728 TGGGTGGGACCCGGAGCAGCTGG - Intronic
1077239592 11:1503563-1503585 CCGTGGGTCCCCAGAACAGCGGG + Intergenic
1077393823 11:2311607-2311629 AGGTGGGGACCAGGAGCTGCAGG - Intronic
1079689458 11:23403696-23403718 CCCTGGGGCCCTGGAGCAGGTGG + Intergenic
1081807724 11:45899572-45899594 TGGAGGGGCCCCGGGCCAGCTGG + Intronic
1083265940 11:61546884-61546906 GGGTGGGCCCCGGGACCAGCTGG + Intronic
1083572915 11:63769439-63769461 GGGTCGGGCCCCGGCGCAGCCGG - Intergenic
1083815876 11:65132262-65132284 CCGTGGGGCCTCTGTGCAGCTGG - Exonic
1083894676 11:65613979-65614001 GGGTGGGGCCCCGGGGCCTCCGG + Exonic
1083970452 11:66070860-66070882 CGGCGGGGCGCCGGGGGAGCGGG + Intronic
1084191765 11:67502629-67502651 CGGATGGGCCCGGGGGCAGCGGG - Exonic
1084647551 11:70467266-70467288 CGGGGGGGCCCCCGAGAAGATGG + Intergenic
1084669266 11:70595694-70595716 CGGTGGGGCCTCCCAGCAGCTGG - Intronic
1084732188 11:71080791-71080813 ATGCGGGGCCACGGAGCAGCTGG - Intronic
1085040438 11:73323618-73323640 AGGAGGGGCCCAGGAGCGGCAGG - Intronic
1085082728 11:73647580-73647602 GGGCGGGGCCCGGGGGCAGCTGG + Intronic
1085332817 11:75667721-75667743 CGCTGAGGCCCGGGAGCAGGAGG - Exonic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1088314973 11:108498288-108498310 CGCGGGGGCCCCGGAGGTGCTGG - Exonic
1089462425 11:118660999-118661021 CTGTGGGGCCCAAGGGCAGCTGG - Intronic
1091385984 12:94925-94947 TCCTGGGACCCCGGAGCAGCTGG + Intronic
1094840769 12:34341818-34341840 GGTTCGTGCCCCGGAGCAGCTGG + Intergenic
1096102794 12:48979676-48979698 AGGTGGGGCCCTGGAGCAGTGGG - Exonic
1096694606 12:53340561-53340583 CAGCGGGGCCGCAGAGCAGCGGG - Intronic
1096771692 12:53939481-53939503 CGGTGGTGCCCGGGATCAGCGGG + Exonic
1102180857 12:110911328-110911350 CGAGGGGGCCCTGCAGCAGCTGG - Intronic
1103532194 12:121610232-121610254 CTGTGAGGCCCCAGAGAAGCTGG - Intergenic
1104026749 12:125033025-125033047 CGCTGCAGCCCCAGAGCAGCTGG + Intergenic
1104943138 12:132404166-132404188 CGGAGGGGACCCAGAGCGGCAGG + Intergenic
1104955176 12:132461233-132461255 GGGTGGGCCTCAGGAGCAGCTGG - Intergenic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1105974309 13:25459789-25459811 GGGTGGGGTTCAGGAGCAGCAGG + Intronic
1112091876 13:96091078-96091100 CGGGGGGCCCCCGGGGCGGCGGG - Exonic
1113847728 13:113402169-113402191 CTGAGTGGCCCCGGAGCAGCTGG - Intergenic
1113848904 13:113407066-113407088 CCTTGGGGCACCGGATCAGCCGG - Intergenic
1114197286 14:20489961-20489983 TGCTGGGGCCCAGGAGCAGGTGG + Intergenic
1114621368 14:24098299-24098321 TGGTGGGGCCCGTGGGCAGCTGG + Exonic
1118450988 14:65902000-65902022 CTGTGTGGCACTGGAGCAGCCGG + Intergenic
1119296481 14:73537493-73537515 CGGCCTAGCCCCGGAGCAGCCGG + Exonic
1119300728 14:73569498-73569520 CGGCCTAGCCCCGGAGCAGCCGG + Exonic
1119303944 14:73592031-73592053 CGGCCTGGCCCCGGAGCAGCGGG + Exonic
1120229717 14:81829495-81829517 CGGGGGGGCCCCGAAGCAGGGGG + Intergenic
1121585562 14:95060774-95060796 CCCTGGGGCCCTGGAGCAGGTGG - Intergenic
1122271438 14:100570055-100570077 CAGTGGGGTCCAGGCGCAGCTGG - Intronic
1122419294 14:101565035-101565057 CGGTAGGGACGCGGAGCGGCTGG - Intergenic
1122822686 14:104355135-104355157 CGGTGGCTCCCCGGCACAGCAGG + Intergenic
1123023157 14:105411589-105411611 CGGCGGGGCCCGGGAGCGCCGGG - Intronic
1124604033 15:31157638-31157660 CAGTGGGGCCTCCAAGCAGCAGG + Intronic
1125677656 15:41511438-41511460 CGGAGGCGCCCGGGAGCGGCGGG - Exonic
1129789502 15:78331412-78331434 GCGTGGGGCCCCGGGCCAGCGGG + Intergenic
1132398208 15:101489473-101489495 CGGCGGGGGCGCGGAGCAGGCGG + Exonic
1132495515 16:261469-261491 CGATGGGGCCCCAGACCTGCTGG + Exonic
1132508624 16:325305-325327 GGAGGGGGCGCCGGAGCAGCGGG - Intronic
1132587996 16:714645-714667 CGGTGGAGCCCCAGAGGAGAGGG - Intronic
1132613419 16:828833-828855 CCCAGCGGCCCCGGAGCAGCAGG - Intergenic
1132621819 16:871380-871402 GTGTGGGGCCCCTGGGCAGCTGG + Intronic
1132793559 16:1706885-1706907 GGGTGGGGTCCCGGGGCAGGCGG - Intronic
1133605644 16:7385248-7385270 CAGTGGGGCCCAGGAGAAGAAGG + Intronic
1134550732 16:15137311-15137333 CGGCGGGGGGCCGGAGCAGAGGG + Intronic
1134708516 16:16317313-16317335 CGGCGGGGGGCCGGAGCAGAGGG - Intergenic
1134715731 16:16357346-16357368 CGGCGGGGGGCCGGAGCAGAGGG - Intergenic
1134951086 16:18351332-18351354 CGGCGGGGGGCCGGAGCAGAGGG + Intergenic
1134959026 16:18394813-18394835 CGGCGGGGGGCCGGAGCAGAGGG + Intergenic
1136447918 16:30335301-30335323 CGCTGGGGCCCCGGAGGACGAGG + Intergenic
1136449162 16:30342981-30343003 CGTGGGGGCCCCTGCGCAGCTGG - Intergenic
1138424152 16:56919413-56919435 CGGCAGGGCCCCTGAGCACCAGG + Intergenic
1138582888 16:57953050-57953072 GGGTAGGGCCACGGAGAAGCTGG - Intronic
1139529902 16:67537862-67537884 CGGTGGGGGCTGGGGGCAGCAGG + Intronic
1141957717 16:87383666-87383688 CGGCCGGGCCCCGGCGCTGCTGG + Exonic
1142227086 16:88882832-88882854 GGGTGGGGCCTGGGAGCAGAGGG - Intronic
1142236410 16:88924571-88924593 TCGTGGGGCCTCGAAGCAGCTGG + Intronic
1142257609 16:89022320-89022342 TGGTGGGGACGTGGAGCAGCTGG - Intergenic
1142880366 17:2878770-2878792 CCGTGGGGCTCCTGGGCAGCAGG - Intronic
1143731459 17:8885124-8885146 AGGTGGGGCCCTGGAGAGGCAGG - Intronic
1146183051 17:30709382-30709404 CGTTGGGGCCGCGGAGCTGCGGG + Intergenic
1146824209 17:36009256-36009278 CGCTGGGGCCCTAGTGCAGCTGG + Intergenic
1147123979 17:38352818-38352840 CGGAGGGGCCCGGGAGGAGGCGG - Exonic
1147393347 17:40122867-40122889 CGGGGCGGCCCCCGGGCAGCAGG + Intronic
1148156975 17:45430153-45430175 CGGTGCTGCGCCGCAGCAGCCGG + Intronic
1148503182 17:48107446-48107468 CAGTGGGTCCCGGGAGCAGAGGG - Intronic
1148793364 17:50185843-50185865 CGTTGGAGCCCTGGAGGAGCAGG + Exonic
1149347169 17:55750918-55750940 GGGTGGGGCCCTGGAGGGGCGGG - Intergenic
1149461726 17:56834343-56834365 GGGTGGGGCCCGGGAGGAGACGG + Intronic
1149893691 17:60412411-60412433 CGGTGGGGCGGGGGAGCAGGTGG + Intronic
1150108437 17:62478660-62478682 AGGCGGGGCGCCGGGGCAGCGGG + Intronic
1151277839 17:73049341-73049363 GGGTTGGGACCAGGAGCAGCTGG + Intronic
1151283258 17:73092224-73092246 GGGAGGGGCCTGGGAGCAGCTGG + Intronic
1151769866 17:76153510-76153532 GGGAGGGGCCTCAGAGCAGCAGG + Intronic
1152754711 17:82082439-82082461 GGGTGAGGCCCTGGAGCTGCAGG - Intronic
1154070270 18:11147278-11147300 AGGCGGGGTCCCGGGGCAGCAGG - Intronic
1155928943 18:31685579-31685601 CGGTGGGGCCCCGGTGCGGCGGG - Intronic
1157359510 18:46964556-46964578 AGCTGGGTCCTCGGAGCAGCGGG + Intronic
1157361104 18:47024075-47024097 AGCTGGGTCCTCGGAGCAGCGGG + Intronic
1157362094 18:47029990-47030012 AGCTGGGTCCTCGGAGCAGCGGG + Exonic
1157362969 18:47035408-47035430 AGCTGGGTCCTCGGAGCAGCAGG + Exonic
1160578784 18:79871935-79871957 TTGTGCGGCCCCAGAGCAGCTGG - Intronic
1160663835 19:313605-313627 CGCTGGGGTCCCAGAGCAGCTGG + Exonic
1160729297 19:633478-633500 TGCTGGGGCCGCGGAGCGGCGGG - Exonic
1160760355 19:781084-781106 CTGTGGGGCCCCGGAGGGGCGGG + Intergenic
1160780725 19:876883-876905 AGGTGGGGCCCCGTGGCAGGTGG - Intronic
1160780750 19:876936-876958 AGGTGGGGCCCCGTGGCAGGTGG - Intronic
1160919514 19:1513188-1513210 CGCAGGGGTCCCGGAGCCGCAGG + Exonic
1160951106 19:1667785-1667807 CCGTGGGGTCCCGGGGCAGCTGG + Intergenic
1161279121 19:3435482-3435504 CTGTGGGGTCCCCGAGCTGCAGG + Intronic
1161337100 19:3720590-3720612 GGGTGGGGCCCAGGCACAGCTGG + Intronic
1162109210 19:8390941-8390963 GGGTGGGGCCCGGGAGAGGCGGG + Intronic
1162744840 19:12792440-12792462 CGGTGGCCACCCGGCGCAGCTGG + Exonic
1162975744 19:14206386-14206408 CGTCGGGGCCGCGGAGCTGCGGG - Intergenic
1163154156 19:15431084-15431106 CCCTGGGGCCCTGGAGCAGGTGG - Intronic
1163556109 19:17993595-17993617 AGGTGGGGCCCCGGAGCAGATGG + Intronic
1165353669 19:35291120-35291142 GGGTGGGGGCTCGGGGCAGCTGG - Intergenic
1165724241 19:38101311-38101333 CGGTGGGGACGTGGAGCAGTGGG + Intronic
1166047157 19:40236265-40236287 CTGTGGGACCCCGGAGTACCTGG - Exonic
1166310451 19:41959390-41959412 TGGCGCAGCCCCGGAGCAGCTGG + Exonic
1168286691 19:55338753-55338775 CTGTGTGGCCCAGGAGCCGCCGG + Intergenic
926170261 2:10548743-10548765 CGATGGGGCCCCGGGGCAACAGG - Intergenic
927713838 2:25340951-25340973 CGGTGGGGACAGGGAGGAGCCGG + Intronic
932621267 2:73265967-73265989 CTGTGGGCCCCCAGAGCAGGAGG + Intronic
934567874 2:95350583-95350605 AGCAGGGGGCCCGGAGCAGCAGG + Intronic
935217833 2:100988739-100988761 CAGTGGGGGCCTGGAGGAGCAGG - Intronic
935217864 2:100988831-100988853 CAGTGGGGGCCTGGAGGAGCAGG - Intronic
935217919 2:100988979-100989001 CAGTGGGGGCCTGGAGGAGCAGG - Intronic
936033112 2:109087774-109087796 AGGTGGGGCCCTGGAGGAGTGGG + Intergenic
937511268 2:122598154-122598176 AGGTGGGGCCTAGGGGCAGCAGG - Intergenic
938311160 2:130288828-130288850 AGGCGCGGCCCCGGAGCTGCAGG - Intergenic
938408207 2:131044418-131044440 CTGTGGCGCCACGGTGCAGCCGG - Exonic
938549824 2:132369783-132369805 CTGTAGGGGCCCGGAGGAGCTGG + Intergenic
938763586 2:134445730-134445752 CGGTGGGGTCTCTGAGCAGGAGG + Intronic
938825651 2:135003019-135003041 GGGTGGGGCCCCGATCCAGCTGG + Intronic
946855391 2:223945127-223945149 AGGTAGGGCCCGGGCGCAGCCGG - Exonic
948074671 2:235156631-235156653 AGGTGGGGCCCCGGAGTATGGGG - Intergenic
948362937 2:237435440-237435462 CCATGGGGCCCCAGAGCAGGTGG + Intergenic
948459901 2:238124018-238124040 CAGTCCGGCCCCGGTGCAGCAGG + Intronic
948513684 2:238489532-238489554 TGGGGAGGCCCTGGAGCAGCTGG - Intergenic
948843807 2:240673233-240673255 CCGTAGGGCCCTGGAGCAGAAGG + Intergenic
948849956 2:240701071-240701093 CCGTAGGGCCCTGGAGCAGAAGG - Intergenic
1168757342 20:326357-326379 CGCGGGGGCCGCCGAGCAGCGGG + Exonic
1169204476 20:3732360-3732382 CGGGGGAGCCCCTCAGCAGCTGG + Intergenic
1172105353 20:32514014-32514036 AGGTGGGGACCCGGAATAGCTGG + Intronic
1175402468 20:58708359-58708381 CGGTGGGGACACGGAGGTGCGGG + Intronic
1175562162 20:59939814-59939836 CGGCGTGGCCCTGGAGCCGCGGG - Exonic
1175960085 20:62631510-62631532 CGGTGGCTCCCAGGGGCAGCCGG + Intergenic
1176177221 20:63734434-63734456 AGGAGGGGCCACGGTGCAGCAGG + Intronic
1176382713 21:6121179-6121201 CTGGGGGGCCTGGGAGCAGCCGG - Exonic
1176385845 21:6138230-6138252 CCTGGGGGCCCCGGAGGAGCGGG + Intergenic
1179737628 21:43400022-43400044 CCTGGGGGCCCCGGAGGAGCGGG - Intergenic
1179740756 21:43417060-43417082 CTGGGGGGCCTGGGAGCAGCCGG + Exonic
1179919616 21:44500350-44500372 ACGTGGGGCCGCAGAGCAGCGGG - Intronic
1180077179 21:45468806-45468828 CGCTGGGGGACTGGAGCAGCTGG + Intronic
1180727342 22:17956198-17956220 CTGTGGGGCCCCGGAGGAGTGGG - Intronic
1181030684 22:20147719-20147741 CAGTGGGGCCCAGGCGGAGCTGG - Exonic
1182099296 22:27646439-27646461 TGCTGGGGCCCTGGAGCGGCAGG + Intergenic
1182122527 22:27797162-27797184 CGGTGGGGGCCCGGGCCATCCGG - Exonic
1183548898 22:38469609-38469631 AGTGGGGGACCCGGAGCAGCAGG + Intronic
1183588524 22:38767054-38767076 CAGTGGGACTCCGGAGCAGAGGG - Intronic
1183664706 22:39240583-39240605 CAGTGGGGCCATGGAGCAACAGG + Intronic
1184954565 22:47877131-47877153 CGGTGGTGGCCCGGACCAGATGG - Intergenic
1185094370 22:48798389-48798411 CTGTGGGGCCCCGGGGCTGAAGG + Intronic
1185232495 22:49691233-49691255 GGGTGGGGCCCTGGCCCAGCAGG + Intergenic
1185273835 22:49941407-49941429 AGGTGGGGACTGGGAGCAGCAGG + Intergenic
1185415174 22:50705647-50705669 GGGGGGAGCCCTGGAGCAGCAGG + Intergenic
950448173 3:13050113-13050135 GGGTGGGGCACCGAGGCAGCTGG - Intronic
950584162 3:13880694-13880716 CAGTGGGGCGCCTGAGCCGCGGG + Intergenic
952978124 3:38713612-38713634 AGGTGGGGCCCCGGAGCTCAGGG + Intronic
953326110 3:42013718-42013740 CGGGTGGGCCCCGGGGCGGCGGG - Intergenic
953929819 3:47000294-47000316 CTGTGGCGGCCAGGAGCAGCAGG - Exonic
954145860 3:48633999-48634021 CAGTGGGCTCCCGGGGCAGCTGG - Intronic
954149395 3:48649950-48649972 GGGAGGGGCCCCCAAGCAGCAGG + Intronic
954447259 3:50553426-50553448 AGGTGGTGCCCAGGAGCATCAGG + Intergenic
956675031 3:71725316-71725338 CGCCGGGGCCCGGGAGCCGCCGG - Exonic
957193278 3:77038704-77038726 CGGCGGTGCCCCGGTGCGGCCGG - Intronic
960992775 3:123322644-123322666 GGGTGGGGCCCAGGTGCTGCAGG - Intronic
961398573 3:126616593-126616615 CTGCTGGGCCCCAGAGCAGCTGG + Intronic
961555634 3:127695046-127695068 CGGCAGAGCCCTGGAGCAGCAGG + Exonic
961743274 3:129046959-129046981 CGGAGGGGCCCCGGAGCGGGAGG - Intergenic
963503883 3:146161165-146161187 CGGTGGAGGCACGGAGCAGCAGG + Exonic
964129316 3:153269052-153269074 CGATGGGACCGCGGAGCAGGGGG - Intergenic
966794183 3:183698124-183698146 CGGTGAGGCCCCGGGGCCGAGGG + Intronic
967876977 3:194274071-194274093 AGGTGGGTCCCAGAAGCAGCAGG - Intergenic
968593696 4:1471993-1472015 CGGTGGCGCGCCGCAGCCGCAGG + Intergenic
972686773 4:41360323-41360345 CGCTGCGGCACCGGAGCAGTAGG - Intronic
973705999 4:53581070-53581092 GGGTGGGGACACGGAGCACCTGG - Intronic
973907372 4:55546060-55546082 CGGGGGTTCCCCGGAGGAGCTGG + Intronic
974047335 4:56908585-56908607 CGGTGGGACCCGGGGGCAGGAGG - Intronic
975048683 4:69832211-69832233 GGGAGGGGCGCCGGAGAAGCAGG + Intronic
975825710 4:78317386-78317408 GGGTGTGGGCCCAGAGCAGCTGG - Exonic
985544473 5:502267-502289 GGGTGGGGGGCCGGAGCGGCTGG - Intronic
985632618 5:1021922-1021944 GGGGAGGGGCCCGGAGCAGCAGG - Intronic
985966546 5:3342578-3342600 CGGTGTGGCCCAGGACCAGAGGG - Intergenic
985966575 5:3342726-3342748 CGGTGTGGCCCAGGACCAGAGGG - Intergenic
992444262 5:76819867-76819889 CTGTGGGTGCCAGGAGCAGCGGG - Intronic
992529697 5:77642387-77642409 GGATGGGGCCCCCGGGCAGCTGG + Intergenic
1002349980 5:178576949-178576971 CGCTGGGGCCGGGGCGCAGCGGG - Intronic
1002447069 5:179296266-179296288 TGATGGGACCCGGGAGCAGCCGG + Intronic
1005040366 6:21595272-21595294 CGGCGGCGCCCAGGGGCAGCAGG - Exonic
1005636456 6:27757676-27757698 CTGCAGGGCCCCAGAGCAGCTGG + Intergenic
1006030902 6:31175897-31175919 TGCTGGGGAACCGGAGCAGCTGG - Intronic
1007321397 6:41031031-41031053 GGGTGGGGCCGTGGAGCAGTGGG + Intronic
1007495756 6:42259501-42259523 GGGTGGGGTCCAGGAGCAGGTGG + Exonic
1007519773 6:42442487-42442509 CTGTGGGGCCCCTCAGCAGAGGG - Intronic
1007623521 6:43229240-43229262 CGGTGAGGCCCTGGGGCCGCGGG - Exonic
1013793693 6:113860441-113860463 CGGCGCGCCCCCGGAGCAGGAGG + Exonic
1018213706 6:161506651-161506673 GGGTGGGGCCCAGGAGTGGCAGG + Intronic
1019270276 7:143316-143338 GGGTGGGTCCTTGGAGCAGCAGG + Intergenic
1019414280 7:920267-920289 CGTTCGGCCCCCGGAGCATCAGG + Intronic
1019674904 7:2305081-2305103 CGGTGGGTCACCGAAACAGCTGG + Intronic
1019735164 7:2646855-2646877 CGGCGGCCCCCAGGAGCAGCAGG - Exonic
1021095128 7:16527083-16527105 AGGTGGGGCCCTGGGGCAGGGGG - Intronic
1029097916 7:98103943-98103965 TGGTGGGGTCCTGGAGCTGCTGG - Intergenic
1029104387 7:98163602-98163624 CGGTGGGAGCCCGGAGAAGCTGG - Intronic
1031503402 7:122550131-122550153 TGGTGGGGCCACAAAGCAGCCGG + Intronic
1032037477 7:128531194-128531216 AGGCGGGGCGCCGGGGCAGCGGG + Intergenic
1032084019 7:128874295-128874317 AGGTGGGGACCCTGAGCAGCCGG - Intronic
1034133072 7:148738964-148738986 CGGTGGGTTCAGGGAGCAGCAGG + Intronic
1035097214 7:156365413-156365435 CGGTGGTGCCACGGAGAATCTGG - Intergenic
1035203301 7:157279855-157279877 GGCGGGGGGCCCGGAGCAGCCGG - Intergenic
1035203665 7:157281416-157281438 AGGTTGGGGCCCGGAGCCGCTGG - Intergenic
1039543060 8:38387039-38387061 CGAGGGAGCCCGGGAGCAGCGGG + Intronic
1040065315 8:43140345-43140367 CGGAGGCGCCCGGGAGCCGCGGG - Intergenic
1040471420 8:47738235-47738257 CGGGGGCGCCCCGGGGCCGCGGG + Exonic
1044821658 8:96159642-96159664 TGTTGAGGCCTCGGAGCAGCCGG + Intronic
1047393759 8:124475118-124475140 CGTGGGGCCCCCGCAGCAGCAGG + Exonic
1048877769 8:138850504-138850526 GGGTGGGGCTCCGGCACAGCTGG + Intronic
1049098410 8:140562393-140562415 CGGGGGGCCCTCGGAGCTGCAGG + Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049237270 8:141518597-141518619 CGGCGGGGCCGGGCAGCAGCAGG - Exonic
1049391745 8:142375229-142375251 CTGTGGGTGCCGGGAGCAGCTGG - Intronic
1049617296 8:143581208-143581230 CGGTGAGGCCCCGGGCCAGTGGG - Exonic
1049649942 8:143761203-143761225 CGGCGGGGAGCCGGAGGAGCAGG - Intergenic
1049785882 8:144450543-144450565 CGTAGGGGCCCTTGAGCAGCAGG + Exonic
1049823107 8:144648150-144648172 AGCTGGGGCCGTGGAGCAGCTGG - Intergenic
1049849166 8:144821560-144821582 CCGAGGGGCCCTGGAGCTGCCGG - Intergenic
1050377151 9:4985172-4985194 CGGTGTGGCCCCGGAGAGGGTGG + Intronic
1054782026 9:69174288-69174310 CGGTGGTGCCCAGGAGGAGTAGG + Intronic
1057423222 9:94928433-94928455 CTATGAGGCCCGGGAGCAGCAGG + Exonic
1059277972 9:113111299-113111321 CGGCGTGGCCCGGGAGCAGCGGG - Intergenic
1059278279 9:113113252-113113274 CGGCGTGGCCCGGGAGCAGCGGG + Intergenic
1059467549 9:114478606-114478628 CGGTGGTGCCCTGAGGCAGCAGG - Exonic
1060087277 9:120714205-120714227 CGGCGGGGCCGCGGGGCAGGTGG - Exonic
1061289991 9:129645227-129645249 CCGTGGGGTCCCGGTGGAGCTGG + Intergenic
1061395547 9:130341639-130341661 CTGTGGGGCCCCTGAGTACCTGG + Intronic
1062397439 9:136358148-136358170 CGCCGGGGGCCCGGAGCAGGGGG + Exonic
1062631104 9:137463535-137463557 GGGAGGGGGCCCGGAGCTGCTGG + Intronic
1189333878 X:40158369-40158391 CGGTAGGACCGCGGAGCCGCAGG + Intronic
1191184122 X:57592180-57592202 CTTGGGGGCCCCGGAGCAGCAGG - Exonic
1191213268 X:57910267-57910289 CTTGGGGGCCCCGGGGCAGCAGG + Exonic
1196707423 X:118727927-118727949 AGGTGGGACCCGGGAGCTGCGGG + Intronic
1198338846 X:135693876-135693898 CAGTGGGGCCAAGGAGGAGCAGG - Intergenic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1200003209 X:153072565-153072587 CTGTGGGGACCCGGACCAGGAGG + Exonic
1200004514 X:153077444-153077466 CTGTGGGGACCCGGACCAGGAGG - Intergenic