ID: 900796752

View in Genome Browser
Species Human (GRCh38)
Location 1:4712640-4712662
Sequence TTCCCCGTTGTTGCTGGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900796752_900796762 8 Left 900796752 1:4712640-4712662 CCAGTCCCAGCAACAACGGGGAA 0: 1
1: 0
2: 1
3: 8
4: 125
Right 900796762 1:4712671-4712693 GCCCCCAAGGATTCTGGGGGAGG 0: 1
1: 0
2: 3
3: 17
4: 187
900796752_900796767 15 Left 900796752 1:4712640-4712662 CCAGTCCCAGCAACAACGGGGAA 0: 1
1: 0
2: 1
3: 8
4: 125
Right 900796767 1:4712678-4712700 AGGATTCTGGGGGAGGCCTCAGG 0: 1
1: 1
2: 1
3: 51
4: 529
900796752_900796761 5 Left 900796752 1:4712640-4712662 CCAGTCCCAGCAACAACGGGGAA 0: 1
1: 0
2: 1
3: 8
4: 125
Right 900796761 1:4712668-4712690 CCAGCCCCCAAGGATTCTGGGGG 0: 1
1: 0
2: 1
3: 18
4: 214
900796752_900796755 -5 Left 900796752 1:4712640-4712662 CCAGTCCCAGCAACAACGGGGAA 0: 1
1: 0
2: 1
3: 8
4: 125
Right 900796755 1:4712658-4712680 GGGAAGTCACCCAGCCCCCAAGG 0: 1
1: 0
2: 6
3: 39
4: 266
900796752_900796757 3 Left 900796752 1:4712640-4712662 CCAGTCCCAGCAACAACGGGGAA 0: 1
1: 0
2: 1
3: 8
4: 125
Right 900796757 1:4712666-4712688 ACCCAGCCCCCAAGGATTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 223
900796752_900796759 4 Left 900796752 1:4712640-4712662 CCAGTCCCAGCAACAACGGGGAA 0: 1
1: 0
2: 1
3: 8
4: 125
Right 900796759 1:4712667-4712689 CCCAGCCCCCAAGGATTCTGGGG 0: 1
1: 0
2: 2
3: 49
4: 787
900796752_900796756 2 Left 900796752 1:4712640-4712662 CCAGTCCCAGCAACAACGGGGAA 0: 1
1: 0
2: 1
3: 8
4: 125
Right 900796756 1:4712665-4712687 CACCCAGCCCCCAAGGATTCTGG 0: 1
1: 0
2: 2
3: 25
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900796752 Original CRISPR TTCCCCGTTGTTGCTGGGAC TGG (reversed) Exonic
900796752 1:4712640-4712662 TTCCCCGTTGTTGCTGGGACTGG - Exonic
901245032 1:7723528-7723550 TACCCTCTTGTTGTTGGGACTGG + Intronic
903620655 1:24695803-24695825 TCCCCAGCTGTTGCTGGGTCAGG - Intergenic
904265787 1:29317956-29317978 TTCCCTGATGCTGCTGGGAAGGG - Intronic
904449395 1:30601268-30601290 TTCCCCTGTGTGGCTGGGTCTGG - Intergenic
905125461 1:35713284-35713306 TTCCCTCTTGTTGCCCGGACTGG + Intergenic
906147060 1:43566422-43566444 TTCCCAGTTGTTGATGGGTTTGG + Intronic
912798153 1:112705237-112705259 TGCCTGGTTGGTGCTGGGACTGG - Exonic
914896150 1:151675580-151675602 TTTCCCTATGTTGCTGGGGCTGG + Intronic
917016845 1:170541509-170541531 TTCCACCTTAGTGCTGGGACTGG - Intronic
919271545 1:195354865-195354887 TTCCCCTGTGTTGCTCAGACAGG + Intergenic
923790297 1:237105969-237105991 TCCCACGTTGGTGCTGGCACTGG - Intronic
1067337610 10:45377766-45377788 ATCTCTGCTGTTGCTGGGACAGG - Intronic
1070801237 10:79245502-79245524 TTCCCCATTGGAGTTGGGACGGG + Intronic
1071108570 10:82127658-82127680 TTCCCAGTTGGTGCCAGGACAGG + Intronic
1071835581 10:89414604-89414626 TTTCCTGTTCTTGCTGGGGCTGG + Exonic
1073798017 10:107009639-107009661 TTTCATGTAGTTGCTGGGACAGG + Intronic
1074351623 10:112743417-112743439 TTCCACTTTGTGGCTGGGGCTGG + Intronic
1074530115 10:114291274-114291296 TTCTCTGTAGTTGCTGGGAGGGG - Exonic
1075202408 10:120415887-120415909 GTCACAGTTGCTGCTGGGACTGG + Intergenic
1076854724 10:133110268-133110290 CTCCGCATTCTTGCTGGGACAGG + Intronic
1077800713 11:5533283-5533305 ATTCCTGTTGCTGCTGGGACAGG + Intronic
1080445713 11:32335202-32335224 TTCCCCCGTGTGGCTGGGTCTGG + Intergenic
1084101401 11:66951975-66951997 TTCCCCGTTGTTACCGTGACTGG + Intronic
1084660581 11:70544287-70544309 TTCCCCGTAGCTGCTGGGACTGG - Intronic
1084741933 11:71145773-71145795 TTCCCCATCGTGGCTGGGGCCGG + Intronic
1087324949 11:96710362-96710384 TTCCCTGATGTTTCTGGCACAGG + Intergenic
1093012693 12:14125789-14125811 TTCTCAGTTGATGCTGGAACAGG - Intergenic
1094322937 12:29205166-29205188 ATCACCCTTGTTGCTGTGACTGG + Intronic
1098830884 12:75361122-75361144 TACCTCTTTGTGGCTGGGACTGG + Intronic
1099115673 12:78621075-78621097 TTCCCTGTTGTTGATGAGGCTGG + Intergenic
1102109189 12:110351500-110351522 TTCCCCGTTGTTGATAGGTATGG + Intergenic
1107300832 13:38964100-38964122 CGCCCCTTTGTTGCTGGGCCTGG - Intergenic
1120134571 14:80851182-80851204 TTTACCCTTGTTTCTGGGACAGG - Intronic
1123687105 15:22806544-22806566 CTCCCTGTTGTTGCTGAGGCCGG + Intronic
1125703303 15:41708112-41708134 TTTCCCTTTGTTTCTAGGACAGG + Exonic
1125859353 15:42983633-42983655 TTCGCTGTTGTTGCTGAGGCTGG - Intronic
1126619292 15:50620900-50620922 TTCACTCTTGTTGCTGAGACTGG - Intronic
1130960691 15:88657007-88657029 TTCCCCGCTGCTGCTGGCCCGGG + Intergenic
1134067316 16:11237079-11237101 TTCCCCATTCTGGCTGGGCCTGG + Intergenic
1134167182 16:11940318-11940340 TTCTCCCTTGTTGCTGAGGCTGG - Intronic
1134239381 16:12494174-12494196 TTCGCTGTTGTTGTTGAGACAGG - Intronic
1134493524 16:14713399-14713421 TTCTCCCTTGTTGCTGAGGCTGG + Intronic
1134498904 16:14752523-14752545 TTCTCCCTTGTTGCTGAGGCTGG + Intronic
1134525457 16:14939140-14939162 TTCTCCCTTGTTGCTGAGGCTGG + Intronic
1134546948 16:15117238-15117260 TTCTCCCTTGTTGCTGAGGCTGG - Intronic
1134547433 16:15121722-15121744 TTCTCCCTTGTTGCTGAGGCTGG - Intronic
1134581663 16:15376496-15376518 TTCTCCCTTGTTGCTGAGGCTGG - Intronic
1134677717 16:16102330-16102352 TTACCCATTGCTGCTGGCACAGG + Intronic
1134713042 16:16337626-16337648 TTCTCCCTTGTTGCTGAGGCTGG + Intergenic
1134720911 16:16380986-16381008 TTCTCCCTTGTTGCTGAGGCTGG + Intronic
1134946516 16:18330899-18330921 TTCTCCCTTGTTGCTGAGGCTGG - Intronic
1134953777 16:18371046-18371068 TTCTCCCTTGTTGCTGAGGCTGG - Intergenic
1138216866 16:55212237-55212259 TTCCCAGTTGTTGCTGCAACTGG + Intergenic
1138683669 16:58706026-58706048 GTCCCCATGGTTGCTGGGATGGG - Intergenic
1138741652 16:59317621-59317643 TTCGCTGTTGTTGCCGGGGCTGG - Intergenic
1139659335 16:68410193-68410215 TGCCCCGTGGGTGCTGGGGCTGG + Intronic
1143080180 17:4375826-4375848 CTCCCCTTTGGTGCTGTGACCGG - Intergenic
1143080410 17:4377251-4377273 CTCCCCTTTGGTGCTGTGACCGG + Intergenic
1143199176 17:5100268-5100290 TTCGCCCTTGTTGCTGAGGCTGG - Intergenic
1143741655 17:8958786-8958808 TTCCCTCTTGTTGCTTGGGCTGG + Intronic
1146617652 17:34369724-34369746 TTGCCCATTCCTGCTGGGACCGG + Intergenic
1147605920 17:41773633-41773655 TTCCCCTCTGTTGCTGGGGAAGG - Intronic
1149622286 17:58054878-58054900 CTCCCTGTTGTTGCTGGCCCTGG - Intergenic
1151458125 17:74238835-74238857 TTCCCTCTTGTTGCTGAGGCTGG - Intronic
1152648378 17:81480838-81480860 CTCCCCTTTGTTGCTGGCCCTGG + Intergenic
1153225424 18:2896203-2896225 TCTCCCTTTGTTGCTGGGGCTGG + Intronic
1153554666 18:6298842-6298864 TTCCCTCTTGTTGCTGAGTCTGG - Intronic
1154173856 18:12068893-12068915 TGCCCCGTTGTTTCTGAGAGTGG + Intergenic
1157497154 18:48164270-48164292 CTCCCGCTTGTTGCTGGGACCGG - Intronic
1160689475 19:454758-454780 TTCCCTCTTGTTGCTGAGGCTGG - Intronic
1161364205 19:3868843-3868865 TTCCAGGTTGGGGCTGGGACTGG + Intronic
1162823232 19:13235980-13236002 TTCCCCATTGTGGGTGGGGCTGG - Intronic
1163613690 19:18313847-18313869 TTCTCTGTTGTTGCTCAGACTGG + Intronic
1163936598 19:20450760-20450782 TTCACTCTTGTTGCTGAGACTGG - Intergenic
1166788346 19:45382822-45382844 TTTCAGGTGGTTGCTGGGACAGG - Intronic
1167039142 19:47012122-47012144 TTCCCTCTTGTTGCTGAGGCTGG - Intergenic
1167716657 19:51146632-51146654 TTGCCCTTTGTTTCTGGGAAGGG + Intronic
925098481 2:1226426-1226448 TTCCCAGTTGGTGCTGGGGATGG - Intronic
927596208 2:24400342-24400364 GTCCCCTTTGTTGATGGGAGGGG - Intergenic
930669617 2:54134748-54134770 TTCCCCCTTGTTCTTGGGTCGGG + Intronic
930964054 2:57298025-57298047 TTCACTGTTGTTGCTGGGGCTGG - Intergenic
931219440 2:60276086-60276108 GTCCTCTTTGTTGCTGGGGCTGG + Intergenic
931838711 2:66127086-66127108 TTCCCAGCTGTTGCTGGAACGGG + Intergenic
934860970 2:97763377-97763399 TTCCCCAGTGCTGCTGGTACTGG + Intronic
938230057 2:129650634-129650656 TGCCCCGTGGTAGCTGGGACCGG - Intergenic
941059292 2:160827401-160827423 TTCCCAGTTGCTGCTGTGTCTGG - Intergenic
944537972 2:200729983-200730005 TTTCCCCTTGTTGCTGAAACTGG - Intergenic
945597873 2:211817539-211817561 TTCCCCTTTGATGCTGTGGCAGG + Intronic
1173267647 20:41499918-41499940 TTCCCCTTTGTAGCTGGAAAAGG + Intronic
1173506035 20:43587843-43587865 TTCCCCGTGATTCCTGGGGCAGG - Intronic
1175865099 20:62171383-62171405 TTGCCAGCTGTTGCTGGAACCGG + Intronic
1178074497 21:29002512-29002534 TTCCCAGATGTTGCTGCAACTGG - Intergenic
1180875123 22:19171601-19171623 TCTCCCGTTGCTGCTGGGGCTGG - Intergenic
1184512047 22:44939641-44939663 CTCCTCGTTGATGCTGGGACAGG - Intronic
955534098 3:59904808-59904830 TTCCCCTGTGTGGCTGGGCCTGG + Intronic
961192150 3:124970992-124971014 TTCTGCATGGTTGCTGGGACAGG - Intronic
961546322 3:127636437-127636459 TTCCCCTTTGTTCCTGGGAGAGG - Intronic
966496299 3:180585474-180585496 TCCCTAGTTGTTGCTGGGATGGG + Intergenic
967184539 3:186933275-186933297 TTCCCCAATGTGGCTGGGTCAGG - Intronic
969893348 4:10279968-10279990 TTCACCGTAGTTACTAGGACAGG - Intergenic
972529006 4:39944662-39944684 TTCGCCGTTGTTGCCCGGGCTGG - Intronic
975319974 4:72999018-72999040 TTCACTGTTGTTGCTGAGGCTGG + Intergenic
977232270 4:94465965-94465987 TTCCCCTTTGTTTTTGAGACAGG + Intronic
983209241 4:164941706-164941728 TTCACTCTTGTTGCTGAGACTGG - Intergenic
985774064 5:1831594-1831616 TTCCCTGGTGCTGCTGGGGCAGG + Intergenic
987995778 5:25276521-25276543 TTCCCCTGGGTTGATGGGACAGG - Intergenic
989378203 5:40787433-40787455 TTCACTCTTGTTGCCGGGACTGG - Intronic
992425033 5:76648177-76648199 CTCCTCGTTATTGCTGGGAGGGG - Intronic
995516753 5:112962021-112962043 TTCCCCTGAGTAGCTGGGACAGG + Intergenic
997826066 5:137107907-137107929 TTCCCTGATGATGATGGGACAGG + Intronic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1002417377 5:179127535-179127557 CTCCCAGATGTTTCTGGGACAGG - Intronic
1004866655 6:19859345-19859367 TTCCTAGTTGTTGCTGAGGCAGG - Intergenic
1009895748 6:69746720-69746742 TTCACCTTTGATGCTGGGGCTGG + Intronic
1014920845 6:127213386-127213408 TTCCCTCTTGTTGCTCAGACTGG + Intergenic
1019045560 6:169142706-169142728 GGACCCTTTGTTGCTGGGACAGG - Intergenic
1020730485 7:11872747-11872769 CTCACTGTTGTTGCTGGGGCTGG + Intergenic
1025014905 7:55431381-55431403 TTCCCAGTTGTTTCTGTGTCAGG - Exonic
1027363814 7:77435964-77435986 TTCCCCGTTGTTGCCCAGGCTGG - Intergenic
1033474510 7:141678156-141678178 TTCACCGTTGTTGCTCAGGCTGG + Intronic
1035008077 7:155684771-155684793 TTCCCCTCTGTTTCTGGGCCTGG + Intronic
1035666402 8:1383635-1383657 TTCCCCTTAGTGGCTGGGGCTGG + Intergenic
1040303318 8:46199375-46199397 TGCCCCATTTTTGCTGGGGCGGG - Intergenic
1056859058 9:90162998-90163020 TTTCTCTTGGTTGCTGGGACAGG - Intergenic
1057166147 9:92927595-92927617 GTTCCCGTTGTTGCCGGGAGCGG + Intergenic
1059073710 9:111166741-111166763 TTCCCTCTTGATGCTGGGTCTGG - Intergenic
1059150626 9:111946523-111946545 TTCGCCCTTGTTGCTGAGGCTGG - Intergenic
1061345432 9:130020844-130020866 TTCCCCGTTGTTCCTGCAATGGG - Intronic
1062068952 9:134544958-134544980 CTCCCCTCTGTTGCTGGGCCTGG - Intergenic
1203771582 EBV:52493-52515 TTCCCCGTCGTTGCTGCCGCGGG + Intergenic
1190909580 X:54758732-54758754 TTCCCCGGTTTTCCAGGGACAGG + Exonic
1196288831 X:113915357-113915379 TTCCCCCATGTGGCTGGGTCTGG - Intergenic
1199454178 X:148009151-148009173 TTCACTCTTGTTGCTGAGACTGG - Intronic
1201665909 Y:16453902-16453924 TTCACCCTTGTTGCTGAGCCTGG + Intergenic