ID: 900796858

View in Genome Browser
Species Human (GRCh38)
Location 1:4713153-4713175
Sequence CCCATGGACGGGGGCATGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 241}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900796850_900796858 -6 Left 900796850 1:4713136-4713158 CCTTCAAGGGTATGGGACCCATG 0: 1
1: 0
2: 1
3: 5
4: 79
Right 900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG 0: 1
1: 0
2: 0
3: 23
4: 241
900796843_900796858 12 Left 900796843 1:4713118-4713140 CCCCAGAGTCTTCAAAAGCCTTC 0: 1
1: 0
2: 1
3: 18
4: 237
Right 900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG 0: 1
1: 0
2: 0
3: 23
4: 241
900796841_900796858 16 Left 900796841 1:4713114-4713136 CCCGCCCCAGAGTCTTCAAAAGC 0: 1
1: 0
2: 1
3: 20
4: 262
Right 900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG 0: 1
1: 0
2: 0
3: 23
4: 241
900796845_900796858 10 Left 900796845 1:4713120-4713142 CCAGAGTCTTCAAAAGCCTTCAA 0: 1
1: 0
2: 1
3: 16
4: 225
Right 900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG 0: 1
1: 0
2: 0
3: 23
4: 241
900796840_900796858 17 Left 900796840 1:4713113-4713135 CCCCGCCCCAGAGTCTTCAAAAG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG 0: 1
1: 0
2: 0
3: 23
4: 241
900796842_900796858 15 Left 900796842 1:4713115-4713137 CCGCCCCAGAGTCTTCAAAAGCC 0: 1
1: 0
2: 2
3: 16
4: 198
Right 900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG 0: 1
1: 0
2: 0
3: 23
4: 241
900796839_900796858 18 Left 900796839 1:4713112-4713134 CCCCCGCCCCAGAGTCTTCAAAA 0: 1
1: 0
2: 0
3: 17
4: 138
Right 900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG 0: 1
1: 0
2: 0
3: 23
4: 241
900796838_900796858 19 Left 900796838 1:4713111-4713133 CCCCCCGCCCCAGAGTCTTCAAA 0: 1
1: 0
2: 1
3: 10
4: 197
Right 900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG 0: 1
1: 0
2: 0
3: 23
4: 241
900796844_900796858 11 Left 900796844 1:4713119-4713141 CCCAGAGTCTTCAAAAGCCTTCA 0: 1
1: 0
2: 2
3: 23
4: 278
Right 900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG 0: 1
1: 0
2: 0
3: 23
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900796858 Original CRISPR CCCATGGACGGGGGCATGGA CGG Intronic
900681626 1:3919944-3919966 CCTGAGGACGGGGGCATGGGTGG - Intergenic
900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG + Intronic
903281347 1:22251760-22251782 CCCAAAGAGGGGGACATGGATGG - Intergenic
903325551 1:22566843-22566865 CCCATTCAAGGGGACATGGATGG + Intronic
903371422 1:22838561-22838583 CCCAGGGCCTGGTGCATGGAAGG - Intronic
904410180 1:30320385-30320407 CCCATGGTCGGTGGCAGGGCTGG + Intergenic
905466558 1:38158697-38158719 CCCATGTATGGTGGCAGGGATGG + Intergenic
905763608 1:40581642-40581664 TCCATGGACAGGGGCGAGGAGGG - Intergenic
909115372 1:71527431-71527453 CCCATGGATGGATGGATGGATGG - Intronic
916832163 1:168504210-168504232 CCCTAGGACAGGGGCATGGAAGG + Intergenic
918250467 1:182699164-182699186 CCCAGGGATGGAGGCATGCAGGG - Intergenic
918779771 1:188684546-188684568 TCCATGGACTGGGGCAGGGAGGG + Intergenic
919764332 1:201116416-201116438 CACAGGGACTGGGGCAGGGAAGG - Intronic
920069532 1:203292284-203292306 CCCCTGGAAGTGGGGATGGAGGG + Intergenic
922116298 1:222617905-222617927 GGCAGGGACGGGGGCAGGGACGG - Intergenic
1062958878 10:1558217-1558239 CCCATGGAGGGGGGCAGAGGTGG - Intronic
1065778245 10:29142709-29142731 GCCCAGGACGGGGGCATGGTGGG - Intergenic
1070824690 10:79384335-79384357 CCCATGGCCGGGTCCCTGGAAGG + Exonic
1072717054 10:97759317-97759339 CCCAAGGACGGGTGCCTGGTTGG - Exonic
1073354802 10:102845367-102845389 CCCAGGGATGGTGGCCTGGATGG + Intergenic
1073975159 10:109092371-109092393 CCCAAGGACAGGGGTATGCAGGG + Intergenic
1077111516 11:864166-864188 CCCAGGGATGGGGGCAGGGGAGG + Intronic
1077143213 11:1033907-1033929 CCAATGGGCAGGGGCAAGGAGGG - Intronic
1077354052 11:2106594-2106616 TGCATGGATGGGTGCATGGATGG + Intergenic
1077354055 11:2106606-2106628 TGCATGGATGGGTGCATGGATGG + Intergenic
1077354081 11:2106746-2106768 TGCATGGATGGGTGCATGGATGG + Intergenic
1077395212 11:2317112-2317134 CCCAGGGATGAGGGCTTGGATGG - Intronic
1080779154 11:35414976-35414998 GCCATGGAGGAGGGCAGGGAGGG + Intronic
1083324784 11:61867648-61867670 CCCAAGGAGGGTGGCATGGAGGG + Intergenic
1084143320 11:67249046-67249068 CCCTTGCACGGGAGCAGGGAAGG + Intronic
1084419526 11:69053349-69053371 CCCATGGACCGGGACAGTGAGGG + Intronic
1084889210 11:72228520-72228542 CCAAGGGACAGGGGCAGGGAGGG - Intronic
1085112376 11:73899298-73899320 GCCTTGGACTGGGACATGGAAGG + Intronic
1086034548 11:82400830-82400852 CCTAAGGAGGGGGGCATGGAGGG + Intergenic
1086973993 11:93112786-93112808 CCCGTGGAAATGGGCATGGAGGG - Intergenic
1089096968 11:115927410-115927432 CCCATGGAAGGGGGCAAGGGAGG - Intergenic
1089365164 11:117917091-117917113 CCCAGGGATGGGGGCAGGCAGGG - Intronic
1089560114 11:119339580-119339602 CCGGTAGACGGTGGCATGGACGG + Exonic
1091121679 11:133063005-133063027 CCCATGGCCGGGGGCCAGCATGG + Intronic
1094075115 12:26464156-26464178 TCCATGGACTGGGGCGTGGGGGG + Intronic
1096365536 12:51026079-51026101 CCCAAAGATGGGGGCAGGGAGGG - Intronic
1100291628 12:93220706-93220728 CGCTTGGACGGGGGCAGGGAAGG - Intergenic
1101524259 12:105513543-105513565 CCTATTGACGGAGGCTTGGAGGG + Intergenic
1102201357 12:111059885-111059907 CCCAAGGTCGGGGGCAGGGAAGG - Intronic
1103364465 12:120371090-120371112 CCCCTGGACTGGGGACTGGAGGG + Intergenic
1104204069 12:126619383-126619405 GCCATGCACAGGGGCTTGGAAGG + Intergenic
1104538520 12:129641137-129641159 TCCATGGACCGGGGCAGGGTGGG - Intronic
1105709087 13:22988564-22988586 GCCATGGAGGAGGGAATGGAAGG + Intergenic
1105761159 13:23515667-23515689 CCCGTGGGCGGGGGCATGCCTGG + Intergenic
1107715948 13:43199601-43199623 CACAAGGGCGGGGGCTTGGAGGG + Intergenic
1112938147 13:104826450-104826472 CCCAAGGTCAGGGGCATGCAAGG - Intergenic
1113459367 13:110471237-110471259 CCCCTGTAGGGGGGAATGGATGG + Intronic
1117436394 14:55718731-55718753 TCAATGGAGGGGCGCATGGATGG - Intergenic
1118655123 14:67939204-67939226 CACATGGAGGGGGGCAGGGGCGG - Intronic
1118713249 14:68539691-68539713 CCCATGAATGGGGCCATGGAGGG + Intronic
1119196470 14:72720441-72720463 CCCATGCACGGAGCCATGGAAGG - Intronic
1119542579 14:75450475-75450497 CCCATGGCTGGGGGCACGGGTGG - Intronic
1121255570 14:92528039-92528061 CTCAGGGAGGGGGGCGTGGAAGG + Intronic
1121835461 14:97088349-97088371 CCCATGGATGGGAGAATGGAAGG - Intergenic
1122334678 14:100963686-100963708 CCCACGGACCAGGGCAGGGAGGG - Intergenic
1122429417 14:101630438-101630460 CCCAGGGATGGGGGCACGGCTGG - Intergenic
1122724302 14:103740200-103740222 ACCCTGGCCGGTGGCATGGAGGG - Exonic
1122900890 14:104781932-104781954 CCCACTGGCAGGGGCATGGAGGG - Intronic
1122976408 14:105172677-105172699 CTCATGGAGGGTGGCATGGCAGG - Intergenic
1202851561 14_GL000225v1_random:23407-23429 CCCAGGGACAGGGACATCGAAGG + Intergenic
1124389135 15:29238183-29238205 CCCAGGGATGGGGGCAAGGAAGG + Intronic
1124955754 15:34359262-34359284 CCCATAGAGTGGGTCATGGAGGG + Exonic
1126608659 15:50506449-50506471 CCCATGGATGGGGGCCGGGGCGG - Exonic
1127686903 15:61354742-61354764 CCCATGGTGGAGGGCAGGGAAGG + Intergenic
1128603823 15:69019277-69019299 GCCATGGAAGGGGGCAGGGAGGG + Intronic
1129604333 15:77017499-77017521 TCCAGGGAGGTGGGCATGGAGGG - Intronic
1130964304 15:88685807-88685829 CCCAGGGGAGGGGTCATGGAGGG + Intergenic
1132338858 15:101065622-101065644 ACCATGGAGGGGGCCATGTAGGG - Exonic
1132626497 16:894100-894122 CCGGTGGACAGGGGCATGGGTGG - Intronic
1133510322 16:6451868-6451890 GCCATGGATGGAGTCATGGAAGG - Intronic
1133510360 16:6452010-6452032 GCCATGGATGGAGTCATGGAAGG - Intronic
1133510367 16:6452038-6452060 TCCATGGATGGAGCCATGGAAGG - Intronic
1133510373 16:6452066-6452088 GCCATGGATGGAGTCATGGAAGG - Intronic
1133510380 16:6452094-6452116 GCCATGGATGGAGCCATGGAAGG - Intronic
1133510386 16:6452122-6452144 CCCATGGATGGAGTCATGGAAGG - Intronic
1133510415 16:6452246-6452268 GCCATGGATGGAGTCATGGATGG - Intronic
1133510421 16:6452274-6452296 GCCATGGATGGAGTCATGGAAGG - Intronic
1133510432 16:6452330-6452352 GCCATGGATGGAGCCATGGAAGG - Intronic
1134488427 16:14677712-14677734 CCCATGGATGGATGGATGGATGG + Intronic
1135470967 16:22730259-22730281 TCCATGGACTGGGGCAGGGTTGG - Intergenic
1135769919 16:25209936-25209958 CCCATGGATGGATGGATGGATGG - Intergenic
1136060970 16:27726242-27726264 CCCATGGATGGTGGCAGGGGTGG - Intronic
1136715384 16:32277682-32277704 CCCATGGACAGGGGTTTGAATGG - Intergenic
1136752531 16:32652053-32652075 CCCATGGACAGGGGTTTGAATGG + Intergenic
1136822060 16:33328396-33328418 CCCATGGACAGGGGTTTGAATGG - Intergenic
1136828623 16:33384935-33384957 CCCATGGACAGGGGTTTGAATGG - Intergenic
1136833689 16:33483717-33483739 CCCATGGACAGGGGTTTGAATGG - Intergenic
1138360308 16:56422675-56422697 CCCAGGGAAGGGTTCATGGAAGG - Intronic
1140250154 16:73288165-73288187 CCCATGGAGGGAGGGAGGGAGGG + Intergenic
1141065417 16:80909979-80910001 CCCAGGGGCCGGGGCATGCAAGG - Intergenic
1141141337 16:81498577-81498599 CACCTGGGCAGGGGCATGGAGGG - Intronic
1141854843 16:86673934-86673956 CAGATGGATGGGGGGATGGAGGG - Intergenic
1142134399 16:88444948-88444970 CCCAAGGCCCGGGGCATGGCAGG + Intergenic
1203011227 16_KI270728v1_random:240803-240825 CCCATGGACAGGGGTTTGAATGG + Intergenic
1203054670 16_KI270728v1_random:912081-912103 CCCATGGACAGGGGTTTGAATGG + Intergenic
1144050763 17:11495463-11495485 CCCATGCAGAGGGGCATGGCTGG + Intronic
1144386816 17:14755759-14755781 CCCATGAATGGGGACATGAATGG - Intergenic
1144573512 17:16415423-16415445 CCCATGGAAGCTGCCATGGATGG - Intergenic
1145901682 17:28494111-28494133 CACCTGGACTGGGGCAGGGAAGG + Intronic
1146293589 17:31630797-31630819 CCCAGGGTTGGGGGCAGGGACGG + Intergenic
1147875329 17:43616948-43616970 CCCATGGAGAGGGGCGTGGCTGG - Intergenic
1148870550 17:50656751-50656773 GCCATGGACCAGGCCATGGAAGG - Exonic
1151701420 17:75744529-75744551 CCCCTGGACTGGGGCATATAGGG - Intronic
1152155932 17:78632769-78632791 TCCATGGATGGGGGCAGGGGTGG - Intergenic
1152334410 17:79692279-79692301 CCCAGGGACAGCGGCCTGGACGG - Intergenic
1156586914 18:38441218-38441240 GGCATGGGCAGGGGCATGGAAGG + Intergenic
1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG + Intronic
1159024847 18:63174333-63174355 CGCATGGACGGGTGGATGAATGG + Intronic
1159946790 18:74449902-74449924 CCCAGGCACGGGGTCATGAAAGG + Intronic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160734980 19:658301-658323 CCCAGGGCCAGGCGCATGGAGGG + Intronic
1161010775 19:1958533-1958555 GCCCTGGACGGGGGGACGGAGGG - Intronic
1161262770 19:3346725-3346747 CCCAGGCACAGGGGCACGGAGGG - Intergenic
1161328293 19:3673732-3673754 CCCATGGTCGGAGGCCTGCACGG - Intronic
1161581514 19:5083361-5083383 CCCAGTGACGGGGACGTGGACGG + Intronic
1162017483 19:7853347-7853369 CCCAGGGGCGGGGACAGGGATGG + Intronic
1163322725 19:16583995-16584017 CACACGCATGGGGGCATGGAGGG + Intronic
1163588279 19:18175720-18175742 CCCAAGGAGGGGGACATGGGTGG + Intronic
1163773811 19:19206337-19206359 CCCAGGGAATGGGGCAGGGAGGG + Intergenic
1164518089 19:28953565-28953587 CCCATGGAAGAGGACATGTAAGG - Intergenic
1164674693 19:30093357-30093379 CCCATGGTGGGAGGCCTGGAGGG - Intergenic
1165060320 19:33201902-33201924 CCCATGGGGCTGGGCATGGAGGG + Intronic
1166046301 19:40232943-40232965 CCCATGGACTTGGTCAGGGAGGG - Exonic
1166647655 19:44544052-44544074 CTTATGGACAGGTGCATGGATGG - Intergenic
925059549 2:880479-880501 TCCCTGGACGGGGGCGGGGAGGG + Intergenic
925290176 2:2742625-2742647 TGGATGGACGGGGGGATGGAAGG + Intergenic
925985717 2:9213274-9213296 CCAATGGGCGGGATCATGGAAGG + Intronic
926209899 2:10862070-10862092 TACATGGTCGGGGGCATGGTGGG + Intergenic
927855352 2:26524126-26524148 CTCTTGGATGGGGGCAGGGAGGG + Intronic
927996714 2:27492195-27492217 CCCCTGGACCGGGGAATGGAAGG + Exonic
930850292 2:55952673-55952695 CTGATGGTCGGGGGCATGCAGGG + Intergenic
931288258 2:60850354-60850376 CCCATGGAGAGGGGCATGGCAGG + Intergenic
931868691 2:66437749-66437771 CCCCATTACGGGGGCATGGATGG + Exonic
936494290 2:113004690-113004712 CAACTGGCCGGGGGCATGGATGG - Intergenic
936577575 2:113668866-113668888 CCCGTGGACAGGTGGATGGAGGG + Intergenic
936755901 2:115712020-115712042 TCCATGGACTGGGGCAGGGGAGG + Intronic
938138975 2:128781346-128781368 ACCCTGGGCGGGTGCATGGAAGG + Intergenic
938686784 2:133745937-133745959 CCAAGGGATGGGGCCATGGAAGG + Intergenic
939143766 2:138388267-138388289 CCCATGGAAGGTTACATGGAAGG + Intergenic
943669905 2:190649217-190649239 CCCATCGAGGGGGGAAGGGAAGG - Exonic
946156432 2:217809614-217809636 TGCATGGATGGGTGCATGGATGG + Intronic
946156435 2:217809626-217809648 TGCATGGATGGGTGCATGGATGG + Intronic
946806420 2:223475254-223475276 TCCATGGACCGGGGCTGGGAGGG - Intergenic
947866378 2:233400556-233400578 CCCAAGGTAGGGGGCACGGAAGG - Intronic
948585082 2:239014499-239014521 CCCATGGACGAGCTCCTGGAGGG + Intergenic
948903239 2:240966480-240966502 CCCAGGGACGCGCGGATGGATGG - Intronic
1169251319 20:4063498-4063520 CCCAGGGACGGGGGGCTGGTTGG + Intergenic
1170310450 20:14985801-14985823 GCCAGGGTCGGGGGCAGGGAAGG + Intronic
1171307437 20:24118512-24118534 GCCATGGAGGCTGGCATGGATGG + Intergenic
1174859839 20:54080742-54080764 TCCATGGATGGGTGAATGGATGG + Intergenic
1175203951 20:57296940-57296962 TCGATGGACGGGGGCAGGGTGGG + Intergenic
1175670558 20:60899453-60899475 ACCATGGACTGGGGCTGGGAGGG - Intergenic
1175838749 20:62013581-62013603 CCCATAGACAGGGACGTGGACGG - Intronic
1176151027 20:63590756-63590778 ACAGGGGACGGGGGCATGGATGG + Intronic
1177396727 21:20545795-20545817 CCCATGGACGTAGCCATGAAGGG - Intergenic
1180194592 21:46185001-46185023 CCCACTGACGAGGGCATGCAGGG + Intergenic
1180749023 22:18111562-18111584 TCCAGGGGCGGGGGCAGGGAAGG - Intronic
1182025957 22:27119558-27119580 CCAGTGGAAGGGAGCATGGAGGG - Intergenic
1183063733 22:35350095-35350117 CGCTGGGCCGGGGGCATGGAGGG + Intergenic
1184827340 22:46961718-46961740 CTCCAGGACGGGGGCACGGATGG + Intronic
1184860309 22:47169702-47169724 CCCAGGGACCGGGGGAGGGACGG + Intronic
1185030507 22:48440606-48440628 CCCAGGGACAGGGCCATGGAGGG - Intergenic
949408085 3:3735493-3735515 GCCATGGACAGCTGCATGGAGGG + Intronic
950349795 3:12337696-12337718 CCCATGAATGGGGGCAGGGGTGG - Intronic
950590741 3:13934484-13934506 CCCAAGGACGGGGGCAGTGTGGG + Intergenic
950725659 3:14915207-14915229 CCCATGGAGGGGGTCATTGGTGG + Intronic
951383493 3:22015441-22015463 CCCAAGGATGGTGGCAAGGAAGG - Intronic
951496312 3:23331490-23331512 TCAATGGATGGGGGCAGGGAGGG + Intronic
952948270 3:38496184-38496206 CCACTGGACGGGGCGATGGATGG - Intronic
953031116 3:39180612-39180634 CCCAGGGAAGGGAGGATGGACGG + Intergenic
953918430 3:46935551-46935573 CCCATGGAAGAGGGCATTCAGGG - Intronic
954332353 3:49897791-49897813 TCCATGGAGGGAGGCATGGGTGG - Intronic
956028852 3:65013726-65013748 CCCATGGAGGGGGGCGGGGAGGG + Intergenic
956393533 3:68800195-68800217 TTCATGGACTGGGGAATGGAAGG - Intronic
961452026 3:127006561-127006583 CCCATGGGCACTGGCATGGAGGG + Intronic
967080607 3:186046184-186046206 CCAATGGACAGTGGCATCGAGGG - Intergenic
968737447 4:2304700-2304722 CCCGTGGCCGAGGGGATGGATGG - Exonic
969007762 4:4034992-4035014 CGCATGAACGGAGCCATGGAGGG + Intergenic
969423543 4:7110871-7110893 CCCATGGAAAGGGGCAGGCACGG - Intergenic
969643651 4:8413507-8413529 TGCATGGAGGGGTGCATGGAGGG - Intronic
971618550 4:28825430-28825452 CCCATAGACGAGGTCTTGGAAGG - Intergenic
972778675 4:42266289-42266311 CCCATGGGTGGGGGGAAGGAAGG - Intergenic
972809769 4:42570433-42570455 CCCATGGACTGTGCCAGGGAAGG + Intronic
980184563 4:129446020-129446042 CCCTTGGCCGGGGGCATGGGGGG - Intergenic
981298195 4:143156800-143156822 CCCAGAGATGGGGGAATGGAGGG - Intergenic
982347428 4:154376065-154376087 GGCAGGGATGGGGGCATGGAGGG + Intronic
984654190 4:182299765-182299787 GCCAAGGACGGGGGGAGGGAGGG + Intronic
985869169 5:2540294-2540316 CGGATGGACGGGTGGATGGATGG - Intergenic
987873634 5:23651115-23651137 CACATAGATGGGAGCATGGAGGG - Intergenic
991405079 5:66293663-66293685 CAGATGGTGGGGGGCATGGATGG - Intergenic
991943488 5:71877558-71877580 CCCATGGATAGTGGCATGAAAGG + Intergenic
994321653 5:98401672-98401694 CCTATGGAGAGGGGCCTGGAAGG - Intergenic
994632623 5:102304982-102305004 TCCATGAACGTGGGCAGGGATGG + Intergenic
995844169 5:116476147-116476169 CCCAAGGACTGGGGCAGGGCTGG - Intronic
995861330 5:116643953-116643975 TCCATGGACTGGGGCAGGGGAGG + Intergenic
996557127 5:124789980-124790002 GCCATGGACCAAGGCATGGAAGG - Intergenic
999316371 5:150586551-150586573 TACATGGACGGGTGGATGGAAGG + Intergenic
999367599 5:151033314-151033336 CCCATGGCCTGGGGCCTGGAGGG + Intronic
1001782322 5:174380569-174380591 CAGATGGATGGAGGCATGGATGG - Intergenic
1004591633 6:17057640-17057662 CTGAAGGACTGGGGCATGGAGGG - Intergenic
1005794811 6:29348220-29348242 GCCAAGGATGGGGGCATGGTGGG + Intergenic
1008160509 6:48069346-48069368 CCCAAGGAGTGGGGCATGGAGGG + Intergenic
1009443078 6:63705586-63705608 CCCATGGACGGTGGGATGAGGGG - Intronic
1010390484 6:75331556-75331578 CCCAAGGATGGGGACATGGATGG + Intronic
1011940608 6:92837550-92837572 ACCATGGACGGGGGCAAAGTGGG - Intergenic
1014485518 6:121994307-121994329 ACCATGGATAGGGGAATGGATGG + Intergenic
1014746544 6:125207698-125207720 CCCATGGAGGGTGAAATGGAGGG - Intronic
1017161295 6:151368535-151368557 CACTTGGACGAGGGGATGGAGGG - Intronic
1017783224 6:157732884-157732906 GCCAAGGGCGGGGGCAAGGATGG - Intronic
1018628761 6:165804914-165804936 CGCACGGAGGGGAGCATGGAGGG + Intronic
1018628822 6:165805114-165805136 CGCATGGAGGGGAGCATGGAGGG + Intronic
1021552310 7:21884178-21884200 CCTATTGACGGAGGCTTGGAGGG + Intronic
1023263069 7:38377807-38377829 CCCATGTTTGGGGGAATGGATGG - Intergenic
1023402226 7:39798469-39798491 CCCACGGAAGGGGGGATGGGAGG + Intergenic
1023722899 7:43113493-43113515 CCCATGGACGGGTGCAGGAGGGG + Intronic
1024273579 7:47659991-47660013 CCCCTGGGTGGAGGCATGGAGGG - Exonic
1024647394 7:51382191-51382213 CCCACGGAAGGGGGGATGGGAGG - Intergenic
1026904265 7:74053860-74053882 TGGATGGATGGGGGCATGGATGG + Intronic
1028890554 7:95983498-95983520 CTCATGGTCTGGGGCAGGGAAGG + Intronic
1029038604 7:97549484-97549506 GCCCAGGATGGGGGCATGGAAGG - Intergenic
1031992602 7:128207831-128207853 CCCATGGCAGGGGGGCTGGAGGG - Intergenic
1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG + Intergenic
1033275609 7:139969624-139969646 CCCAGGGAGGAGGGCATGGTTGG + Intronic
1034586465 7:152097832-152097854 CCCAGGGACTGGGGAATGGGAGG + Intronic
1035171909 7:157021680-157021702 CCCAAGGTCTGGGGCGTGGAGGG + Intergenic
1035230743 7:157464066-157464088 CCCATGAACTGTGACATGGATGG - Intergenic
1035452649 7:158988242-158988264 TGCATGGATGGAGGCATGGATGG - Intergenic
1035577618 8:717873-717895 CCCAGGGACGGGGGCAGGCCAGG + Intronic
1037323838 8:17669383-17669405 CCCATGGCCGGGGCCTGGGAGGG + Intronic
1037523734 8:19704671-19704693 CCCATAGACGGATGGATGGATGG + Intronic
1038581012 8:28749482-28749504 TCCATGGAGGGGAGCAGGGAGGG - Intronic
1038696803 8:29813457-29813479 TCCATGGATGGGAGCAGGGATGG - Intergenic
1042484388 8:69334640-69334662 CTCATGGACATGGGCATGGAAGG + Intergenic
1044938815 8:97319557-97319579 CCCATCCATGGAGGCATGGAGGG + Intergenic
1046483955 8:114860726-114860748 CCCATTGTCAGGGGCATGGCAGG - Intergenic
1047162153 8:122392555-122392577 CCCAAGGACAGGGCCAGGGATGG + Intergenic
1048522472 8:135169507-135169529 CCCAGGGTCTGGGGCATGGGAGG + Intergenic
1052745960 9:32441239-32441261 CCCATAGAAGGGGCCATGCAGGG + Intronic
1053538223 9:38947038-38947060 CCCATGGGCATGGGAATGGACGG - Intergenic
1054627911 9:67416881-67416903 CCCATGGGCATGGGAATGGACGG + Intergenic
1055926873 9:81519458-81519480 CACATGGAGGGGGGCCTTGAGGG - Intergenic
1057024628 9:91725635-91725657 CCCATGGACAGGCCCATTGAGGG - Intronic
1057408604 9:94796223-94796245 GACATGGAAGGGGGCATGGGAGG - Intronic
1061385069 9:130284901-130284923 CCCATGGAATCTGGCATGGAGGG - Intronic
1061766148 9:132882671-132882693 AGCATGGACTGGGGCAGGGAAGG - Intronic
1061955965 9:133961493-133961515 CCCAAGGTCAGAGGCATGGAGGG + Intronic
1062040349 9:134401694-134401716 CCCAGGGACGGGTGCAGCGAGGG - Exonic
1185547319 X:955784-955806 TGCATGGATGGAGGCATGGATGG - Intergenic
1185547349 X:955984-956006 CTCATGGATGGATGCATGGATGG - Intergenic
1190287996 X:48973199-48973221 CCAATGGTTGGGGGAATGGATGG - Intergenic
1192502038 X:71660769-71660791 CCCGTGGACAGAGTCATGGAAGG - Intergenic
1192509195 X:71712127-71712149 CCCGTGGACGGAGTCGTGGAAGG - Intergenic
1192511527 X:71723036-71723058 CCCGTGGACGGAGTCTTGGAAGG + Intergenic
1192515170 X:71758469-71758491 CCCGTGGACGGAGTCTTGGAAGG - Intergenic
1192517502 X:71769426-71769448 CCCGTGGACGGAGTCGTGGAAGG + Intergenic
1192627579 X:72746167-72746189 TCCATGGACGGATGGATGGATGG - Intergenic
1192654129 X:72974646-72974668 TCCATGGACGGATGGATGGATGG + Intergenic
1193112429 X:77743247-77743269 CGCCTGGACTGGGGCATGAAAGG + Intronic
1194889751 X:99364183-99364205 CCCAGAGACGGTGGCATGGGTGG + Intergenic
1198457839 X:136835055-136835077 GCCAAGGAGTGGGGCATGGAGGG - Intergenic