ID: 900800821

View in Genome Browser
Species Human (GRCh38)
Location 1:4735940-4735962
Sequence GAGCAGAGCTTAGAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900800817_900800821 -1 Left 900800817 1:4735918-4735940 CCATTGCTGGTCAGATTGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 390
900800812_900800821 21 Left 900800812 1:4735896-4735918 CCACGGTGATCTTCAGCCTTTGC 0: 1
1: 0
2: 0
3: 3
4: 118
Right 900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 390
900800814_900800821 5 Left 900800814 1:4735912-4735934 CCTTTGCCATTGCTGGTCAGATT 0: 1
1: 0
2: 0
3: 8
4: 153
Right 900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900800821 Original CRISPR GAGCAGAGCTTAGAGGAAGA GGG Intronic
900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG + Intronic
900813767 1:4827796-4827818 GACCAGAGCTAAGAGGAGGACGG - Intergenic
902616284 1:17625250-17625272 GAGCAAAGGTTAGAGGCAGGAGG + Intronic
902733022 1:18382431-18382453 GAGCAGGGCTTTGGGGAAGAAGG - Intergenic
903676869 1:25069897-25069919 GAGCAAGGCCTAAAGGAAGATGG - Intergenic
903680854 1:25095869-25095891 GAAGAAATCTTAGAGGAAGAAGG - Intergenic
904272049 1:29356542-29356564 AAGCAGAGCTAAGAGAAGGAAGG + Intergenic
904624193 1:31792975-31792997 GAGCAGAGGATAGAGGAGGGAGG - Intronic
905218301 1:36425963-36425985 GAGCTGAGCCTGGAGGAAGAAGG + Intronic
905991083 1:42337289-42337311 GAGCAGAACTAAGAGGACAATGG + Intergenic
906613271 1:47218179-47218201 AGGCAGAGCCTAGAGGGAGAGGG + Exonic
908289698 1:62652007-62652029 GAGCACATCTTGGAGGAAGAAGG - Intronic
911086330 1:93980445-93980467 GAGCTTAGTTTAGAGGAGGAAGG - Intergenic
911692476 1:100850142-100850164 AAGCAGAGATGTGAGGAAGAAGG + Intergenic
911778693 1:101847236-101847258 GAGCAGAGGTTGGAGGGAGGCGG + Intronic
912379555 1:109240038-109240060 GAGCAGGGTTTACAGAAAGAAGG + Intergenic
912573668 1:110644007-110644029 GTGCTGAGCTAAGAGGCAGAGGG - Intergenic
912746959 1:112253013-112253035 GAGCAGAACTTACTGGAAGGTGG + Intergenic
912942443 1:114056956-114056978 TAGTAGAGCTGAGAGGAAGCTGG + Intergenic
914407473 1:147390047-147390069 CAGCAGTGCTTAGGGGAAGAGGG - Intergenic
916076243 1:161201440-161201462 GAGTTGGGCTTAGAGGCAGAGGG + Intronic
916637000 1:166682209-166682231 CAGCACAGACTAGAGGAAGAAGG - Intergenic
918126094 1:181585282-181585304 GAGGAGAGAGTAGAGGGAGAGGG + Intronic
918431415 1:184464756-184464778 GAGCAGAATATTGAGGAAGAGGG + Intronic
918708267 1:187695999-187696021 GGACAGAGCTTAATGGAAGATGG + Intergenic
920125424 1:203690535-203690557 GAACAGATGTGAGAGGAAGATGG + Intronic
921665134 1:217860044-217860066 AAGCAGTGCCTAGAGGAAAATGG - Intronic
921887661 1:220322665-220322687 GAGCAGTCCTTCCAGGAAGAGGG - Intergenic
922465540 1:225843755-225843777 GGGCAGAGCTGAAAGGGAGATGG + Intronic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
923538210 1:234869345-234869367 GAGCAGTGCCTGGAGGAAGCAGG - Intergenic
923790079 1:237104365-237104387 GAGCAGAGTTTTTTGGAAGATGG - Intronic
1063022118 10:2139663-2139685 GAGCAGATTTCAGAGTAAGAGGG + Intergenic
1063767523 10:9159815-9159837 GAGCAGAGCTTAGAAGAATTTGG + Intergenic
1064491400 10:15860719-15860741 GAGCAGTGCGTAGAGGAAGAAGG - Intergenic
1065234720 10:23637432-23637454 CAGCAGAGCTCAGATGAACAGGG + Intergenic
1066411892 10:35179186-35179208 GAAGAGAGATCAGAGGAAGAAGG + Exonic
1066469165 10:35681382-35681404 GCACAGAGCCTGGAGGAAGACGG - Intergenic
1067020897 10:42796769-42796791 GAGAGGAGCTCAGCGGAAGAAGG + Exonic
1067176874 10:43956322-43956344 GAGCAGGGCATGGAGGAGGAGGG + Intergenic
1067319651 10:45205722-45205744 GAGCAGGGCTTAGAGAGGGAGGG - Intergenic
1068104335 10:52594366-52594388 GAGAAGAGGTTAGAGGAAGGAGG + Intergenic
1068726740 10:60311631-60311653 GAGCATAAATTAGAGGCAGAGGG - Intronic
1069114440 10:64487827-64487849 GAGCAGAGCTTATTGGTATAAGG + Intergenic
1069721010 10:70549431-70549453 CTGCAGAGCTCAGAGGAAGGGGG - Intronic
1070960730 10:80498491-80498513 AAGCAGAGCTTAGGGAAATACGG - Intronic
1071113743 10:82193027-82193049 GAGAAGAGCTTAGATTTAGAGGG + Intronic
1071425557 10:85545607-85545629 GAGAAGGGCTTTGAGTAAGAAGG - Intergenic
1071787299 10:88916041-88916063 GATAAGAGTTGAGAGGAAGAGGG - Intronic
1073083266 10:100873096-100873118 GTGCAGAACTTTGGGGAAGATGG - Intergenic
1073566786 10:104541960-104541982 AAGCAGATCTCAGAGGCAGAGGG + Intergenic
1074033859 10:109717980-109718002 GAGCAGGGCTGAGGGGCAGAAGG + Intergenic
1074543253 10:114383823-114383845 AAGCAGAGCTTGGTGGAAGTGGG + Intronic
1075091410 10:119445999-119446021 GAGCAGGGGTTTGGGGAAGATGG - Intronic
1075313520 10:121433853-121433875 GTGGAGAGCATGGAGGAAGATGG + Intergenic
1075336955 10:121615633-121615655 GAACAGAGCTGGGAGGATGAGGG + Intergenic
1075491424 10:122873764-122873786 GAGCAGTGCTTACAGGGAAACGG - Intronic
1075514641 10:123099233-123099255 GAGCAGATCAGAGAGGATGAAGG + Intergenic
1075643670 10:124083946-124083968 GCCCAGAGCTCAGAGGAAGATGG + Intronic
1076617765 10:131768029-131768051 GAGCAGAGCTAGGGGCAAGAGGG - Intergenic
1077237412 11:1488394-1488416 GGGCAGAGCATAAAGGAAGCTGG + Intronic
1077546819 11:3175426-3175448 GAGCAGAGCTGAGAGGTGGGAGG - Intergenic
1077955942 11:7020184-7020206 GAGCTGTGCTTGAAGGAAGAGGG - Exonic
1078668429 11:13344729-13344751 GAGCAGAGGTGAGAGGCTGATGG - Intronic
1079424699 11:20329143-20329165 GGGCAGAGCTTGGAAGAACACGG - Intergenic
1081908008 11:46681316-46681338 GAGCAGAGTTTTGATGAACATGG + Exonic
1082813023 11:57490004-57490026 GAGCAGAGGGTAGAGGAGGAAGG + Intronic
1083016474 11:59459296-59459318 GAGGTGAGTATAGAGGAAGAAGG - Intergenic
1083169130 11:60912183-60912205 GACAAGAGCTCAGATGAAGATGG + Intergenic
1083644549 11:64165016-64165038 GAACAGAGGTTAGAGGAGCAGGG - Intronic
1083934482 11:65863196-65863218 CAGCAGAGCTGTGAGGAGGAGGG + Exonic
1084031328 11:66482367-66482389 GAGCAGAGCATAGATGTAGGGGG - Exonic
1087240860 11:95776660-95776682 AATCAGTGCTTTGAGGAAGAAGG + Intronic
1087916912 11:103821775-103821797 GAGCAGAGGATATAGAAAGAGGG - Intergenic
1088536263 11:110865469-110865491 GAGCAGAGGTGAGGGGAAGCAGG - Intergenic
1088917230 11:114236896-114236918 CAACAGAGCTCAGAGGAAGATGG + Intronic
1089157503 11:116413758-116413780 GAGCTGAGCGTAGGGGCAGAAGG - Intergenic
1089294064 11:117457617-117457639 GCTCAGAGCTTAAAGGGAGAGGG + Intronic
1089329207 11:117678165-117678187 GAGGAGGGATGAGAGGAAGAGGG - Intronic
1089688933 11:120174128-120174150 GAGCAGAGCCAAAATGAAGAGGG - Intronic
1090207513 11:124894055-124894077 ATGCAGAGCTCAGAGGGAGAGGG + Intronic
1090907437 11:131089274-131089296 GAGCAGGGATTCCAGGAAGATGG + Intergenic
1092246901 12:6868747-6868769 GAGCAGAACCAAGAAGAAGAGGG + Intronic
1092669753 12:10849389-10849411 GAGCTGAGCTCAGAGCCAGAAGG + Exonic
1092791977 12:12078295-12078317 AAGCAGAGGGTAGAGGGAGAAGG + Intronic
1092792175 12:12079717-12079739 GAGCAGTGCTTGGAGCATGAAGG + Exonic
1092917555 12:13202372-13202394 GATCAGAGCTGAGAGCAAAACGG + Intronic
1096342359 12:50811849-50811871 GAGCAGAGATCAGAGGTAGTGGG + Intronic
1096849078 12:54424043-54424065 GAGCAGAGCTAAGAGGACACTGG + Intergenic
1097071190 12:56356072-56356094 GAGCTGAGCATAGAGGAGTAAGG - Intronic
1097282654 12:57854231-57854253 GAGCAGAGGGAAGGGGAAGAAGG + Intergenic
1099347471 12:81520696-81520718 GACAACAGCTGAGAGGAAGAGGG + Intronic
1100025612 12:90124119-90124141 GAGCAGAGCATAGAGTATGTAGG + Intergenic
1100343260 12:93701859-93701881 AAGCAGAGATTAGAGAAAGTGGG - Intronic
1100602877 12:96127279-96127301 GAACAGACTTCAGAGGAAGATGG - Intergenic
1101877779 12:108607016-108607038 GAGCGGAGGGGAGAGGAAGAGGG - Intergenic
1101912758 12:108872819-108872841 TAGCAGGGCTTGGAGTAAGATGG + Intronic
1102717931 12:114990245-114990267 GAGCAGGGCCTGAAGGAAGAGGG + Intergenic
1102719712 12:115005623-115005645 GGGCTGACCTTGGAGGAAGATGG - Intergenic
1103086007 12:118061830-118061852 GAGCTGGGCTTAGGGGAAAATGG + Intronic
1103195763 12:119042547-119042569 AGGCAGATCTGAGAGGAAGAGGG + Intronic
1103209049 12:119153740-119153762 GGTCAGACCTAAGAGGAAGAAGG - Intronic
1103797010 12:123510160-123510182 GAGCAGAGCTGACGGGGAGAGGG - Intronic
1104224815 12:126821052-126821074 AAGCAGAGCATAAAGAAAGATGG - Intergenic
1105546635 13:21355521-21355543 GAGCACAGGTGAGAGGAACAAGG + Intergenic
1105662120 13:22508185-22508207 GAGCAGAGCAAAGAGGAAAATGG - Intergenic
1105770666 13:23608891-23608913 GAGCGTAGCTCAGAGGAAGAAGG - Intronic
1106586550 13:31061768-31061790 AAGGACAGCTTAGTGGAAGAGGG + Intergenic
1106755937 13:32822493-32822515 GAGGAGAGCTGAGAAGAAGCTGG + Intergenic
1107659322 13:42623100-42623122 CAGCAAAGTTCAGAGGAAGAAGG + Intergenic
1108225557 13:48285506-48285528 GAGCACAGCAGGGAGGAAGAAGG - Intergenic
1108236549 13:48413928-48413950 GGGAAGAGCTGGGAGGAAGAAGG - Intronic
1108995833 13:56733578-56733600 GATCAGAGCTTGAATGAAGAAGG + Intergenic
1110467901 13:75824010-75824032 GAACAGATCTTGGAGGAAGTAGG + Intronic
1111754875 13:92380344-92380366 GAGCAGAGCTATGAGGAGAAAGG - Intronic
1111769256 13:92575685-92575707 CAGCAGTGCTGAGAGGAATATGG - Intronic
1116905156 14:50396864-50396886 GAGCCGAGCTGGGCGGAAGAAGG - Intronic
1117421893 14:55555021-55555043 GAGTAGAGCCGAGAGAAAGAAGG - Intergenic
1117912580 14:60649234-60649256 GAGCAGAGCCGAGAGGCAGGGGG + Exonic
1117931496 14:60846448-60846470 GAGCAAAGCTTATAAGCAGAAGG - Intronic
1118682624 14:68259153-68259175 GGGCAGAGCTTTGTGGAAGCTGG - Intronic
1119032348 14:71202670-71202692 GAGCAGAGCCTTGAAGAACAAGG + Intergenic
1120694048 14:87624061-87624083 GAGCAGATGTTAGAGAAAAAAGG - Intergenic
1120762844 14:88301730-88301752 CAGCATAGGTTAGAGGAAGACGG + Intronic
1121558344 14:94855561-94855583 CAGGAGAGCTTTGAGGAAGGTGG - Intergenic
1121753793 14:96384272-96384294 TAGCAGAGATAAGAGGAAGAAGG + Intronic
1122046432 14:99027273-99027295 GCCCAGGGCTTGGAGGAAGATGG - Intergenic
1122085356 14:99297241-99297263 GAGCAGAGCTGAGTGGTTGAGGG - Intergenic
1122764208 14:104054288-104054310 GAGCAGTGGGTAGAGGCAGATGG + Intergenic
1122978325 14:105180108-105180130 GGGCTGGGCTTGGAGGAAGACGG + Intronic
1123097666 14:105774089-105774111 GAGCAGGGCTCAGTGGAAGATGG - Intergenic
1124148876 15:27159079-27159101 GAGGAGGGCGTGGAGGAAGAGGG - Intronic
1124382438 15:29177862-29177884 GAAGGGAGCTTAGTGGAAGAGGG + Intronic
1125817160 15:42595806-42595828 CTGCAGAGCTGAGTGGAAGATGG + Intronic
1127221506 15:56885832-56885854 GAACAAATCTTTGAGGAAGAAGG - Intronic
1128246274 15:66134773-66134795 GAGCTGAGCTGTGAGGATGATGG + Intronic
1128562785 15:68679488-68679510 GTGCAGAGCACAGAGGCAGAGGG + Intronic
1128788182 15:70413495-70413517 GAGAAGAGCCTAGATGAAGCAGG - Intergenic
1129364569 15:75046451-75046473 AAGCAGAGCTTGCAGGAAGAAGG - Intronic
1129410921 15:75349851-75349873 GAGGAGAGCCAAGAGGAGGATGG + Intronic
1130355917 15:83130238-83130260 GGTCATAGCTTAGAGGAAAATGG + Exonic
1131252065 15:90837496-90837518 GAGACGAGCTTACAGGAAGGGGG + Intergenic
1131827308 15:96331756-96331778 GAGCAGAACGTGGAGAAAGAGGG - Exonic
1132894946 16:2224219-2224241 CAGCAGAGCCTAGTGCAAGAGGG + Intronic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134405699 16:13956698-13956720 GAGCAGAGCAAAGTGGGAGAAGG + Intergenic
1134771371 16:16812344-16812366 GAGAAGAGGGGAGAGGAAGAGGG + Intergenic
1136549892 16:30977399-30977421 GAGCAGTTCTCAGAGGAAGGTGG + Intronic
1137484017 16:48876702-48876724 GGGTAGAGCTTATAGGAGGATGG + Intergenic
1137623865 16:49895338-49895360 CAGGTGAGCTTAGAGGAAAAGGG + Intergenic
1137646490 16:50079664-50079686 GAGGAGAGCAAATAGGAAGACGG + Intronic
1137887832 16:52125968-52125990 CAGCAGAGTCTGGAGGAAGAAGG + Intergenic
1137946303 16:52736009-52736031 TAGCAGAGTTGAGAGGCAGAAGG + Intergenic
1138573679 16:57892633-57892655 GGTCAGACCTCAGAGGAAGATGG - Intronic
1139213782 16:65107676-65107698 GAGCAGAGTTTATAAGCAGAGGG - Intronic
1140348791 16:74241575-74241597 GAGCTGAGCCAAGAGGAATAGGG + Intergenic
1140487092 16:75302081-75302103 AAGCAGAGCATAAAGGAGGATGG + Intronic
1140625576 16:76790046-76790068 GATCAGAACTTAAAGGAACAAGG - Intergenic
1140700991 16:77581389-77581411 GAGCAGAGCTTAGAGTTTGGGGG - Intergenic
1141308390 16:82888598-82888620 CAGAAAAGCTTGGAGGAAGATGG + Intronic
1141763942 16:86046463-86046485 GGGCTGAGCTTGGAGGAATAGGG + Intergenic
1141767803 16:86070262-86070284 GGGCAGAGTTTAGAAGAAGCCGG + Intergenic
1142407460 16:89898725-89898747 GAGCAGAGCAAAGGGGAACAGGG - Intronic
1142684220 17:1568309-1568331 GAGAAGAGCAGAGCGGAAGATGG - Intergenic
1142988795 17:3715149-3715171 GAGCAGGGTTCAGAGGAAGGTGG - Intronic
1144053795 17:11520533-11520555 GATCACAGCTTAGAGCAAGAAGG - Intronic
1146633964 17:34490702-34490724 GAGGAGTGTTTAGGGGAAGAGGG - Intergenic
1146941209 17:36845576-36845598 TAGCAGTGCTGAGAGGAGGAAGG + Intergenic
1147137517 17:38442760-38442782 GGCCAGAGCACAGAGGAAGAGGG + Intronic
1147472623 17:40677088-40677110 GAGCACAGCCTAGAGAAAGCTGG - Intergenic
1147559471 17:41500055-41500077 GAGCAGATCTGGGAGGATGATGG + Intergenic
1151543525 17:74777475-74777497 GAGCAGACCATAGTGGAAGCAGG + Intronic
1151589638 17:75034752-75034774 GAGCATAGCTGGGAGGAATAGGG + Intronic
1152222833 17:79078535-79078557 GATCAGAGCTTAAGGGAAGAAGG - Intronic
1153598755 18:6757319-6757341 GGGCAGTGTTTAGAGAAAGAAGG + Intronic
1154089464 18:11344054-11344076 GTGCAGAGGGTAGAGGGAGAGGG - Intergenic
1155061689 18:22234386-22234408 GAGCAGAGCTTTGAGGCACTGGG + Intergenic
1156517293 18:37691451-37691473 GTGAACAGCTGAGAGGAAGAGGG + Intergenic
1157437149 18:47680455-47680477 GAGCAGAATTTTCAGGAAGAGGG - Intergenic
1157477787 18:48034504-48034526 GAGGAGGGCTGGGAGGAAGAGGG - Intronic
1157938787 18:51902789-51902811 CAGCAGAGCACAGAGGAAGATGG - Intergenic
1158271934 18:55726037-55726059 GAGCAGTGCCTAGAGCCAGAGGG + Intergenic
1158333148 18:56385019-56385041 GACCACACCCTAGAGGAAGATGG + Intergenic
1159089913 18:63836238-63836260 AACCAGAGTTTAGAGGCAGAAGG - Intergenic
1159231411 18:65611741-65611763 GAGTAGAGCATAGAGGATGAAGG - Intergenic
1160083400 18:75752761-75752783 GAGCAGAGGCTGGAGGAGGAGGG + Intergenic
1161423345 19:4187829-4187851 GAGCAGAGCCTGGAAGAATAGGG + Intronic
1161496655 19:4590236-4590258 GAGCAGAGACTTGAAGAAGAGGG + Intergenic
1161541658 19:4855430-4855452 CTGCTGAGCTTACAGGAAGATGG - Intronic
1163016411 19:14458159-14458181 CAGCAGGGCCTAGAGGAGGAGGG + Intronic
1164398745 19:27888349-27888371 GAGCAGAGTTTGGGGGTAGAAGG + Intergenic
1164564286 19:29314874-29314896 GACTAGAGCTCAGAGGAAGGAGG - Intergenic
1164689123 19:30194902-30194924 TTGCTGAGCTGAGAGGAAGAAGG + Intergenic
1164886201 19:31780581-31780603 GTGAAGAGGTCAGAGGAAGAGGG + Intergenic
1167660050 19:50790977-50790999 GGTCAGAGATTAGAGGTAGAGGG - Intronic
925248119 2:2402895-2402917 GAAAACAGCTTATAGGAAGAAGG - Intergenic
925385244 2:3457636-3457658 GAGCAAGGCTTAGCAGAAGACGG + Exonic
925887111 2:8402456-8402478 GAGAAGAGCTGAGAGGCACAGGG - Intergenic
927272997 2:21233339-21233361 GAGTACAGTATAGAGGAAGAGGG + Intergenic
927966515 2:27273320-27273342 GAGCAGAGCCCAGAGCAAGTAGG + Intronic
928283079 2:29965716-29965738 GATCAGAGAATAGAGGTAGAAGG - Intergenic
930088115 2:47512661-47512683 GAGCAGAGTTCAGAGGCAGTGGG - Intronic
930292623 2:49514853-49514875 GAGAAGAACATAGAGGAGGAGGG + Intergenic
931630679 2:64295804-64295826 GAGCAGGGCTTAGAGGTGTAGGG - Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
934904530 2:98187178-98187200 GAGCAGAGAGCAGAGAAAGAGGG - Intronic
935640010 2:105281498-105281520 GATCAGAGCTTGGATGAAGGAGG - Intronic
936686251 2:114829969-114829991 CAGCAGAGCTTAGAGGAAAATGG - Intronic
937032602 2:118753093-118753115 GACCAGGGCTTGGAGGAGGAGGG - Intergenic
938892757 2:135722162-135722184 GAGCAGAGCAAAGGAGAAGATGG + Intronic
939428753 2:142074867-142074889 GAGGAAAGATTAGATGAAGAAGG - Intronic
939788030 2:146540321-146540343 GAGCTGAGTTTTGAGGTAGAAGG + Intergenic
940405723 2:153299701-153299723 GAGCAGAGCTTGGTGGGAAAAGG + Intergenic
942498005 2:176559748-176559770 GAACTGTGATTAGAGGAAGAAGG + Intergenic
942667149 2:178331899-178331921 AAGCAGAGTTTATTGGAAGATGG - Intronic
942683171 2:178500835-178500857 GAGCTGAACTAAAAGGAAGAGGG - Intronic
944517006 2:200522280-200522302 GAGCAGCTCTTAAAAGAAGAGGG - Intronic
944648269 2:201802345-201802367 GAGAAGGGATGAGAGGAAGATGG - Intronic
944981727 2:205128341-205128363 GGGCATAGCTTCTAGGAAGAAGG - Intronic
947127790 2:226889844-226889866 GTACAGAGCTAGGAGGAAGAGGG - Intronic
947588723 2:231372400-231372422 GAGCAGAGCTTTGAAGAGGCTGG - Intronic
948098482 2:235355232-235355254 AAGCAGAGCTTAGAGTGAGGGGG + Intergenic
948462647 2:238137824-238137846 GAGCAGAGCTTTGTGGCTGAGGG - Intergenic
948566030 2:238886823-238886845 AAACAGAGCGAAGAGGAAGAGGG + Intronic
948761744 2:240196713-240196735 AAGCAGAGTTTAGAGCAACACGG + Intergenic
1169202767 20:3721322-3721344 CAGCAGAAATTAGAGGGAGATGG + Intergenic
1169933540 20:10858707-10858729 GAGCAGGGTATAGAGGAGGATGG + Intergenic
1170053606 20:12174505-12174527 GAGCAGTTCTAAGAGGAAGCAGG - Intergenic
1170207782 20:13817948-13817970 GAGAAGAACATAGAGGAAGCAGG + Exonic
1171392229 20:24809043-24809065 GATGAGAGCTGAGAGGAAAATGG + Intergenic
1172038688 20:32028766-32028788 GAGGAGATAGTAGAGGAAGAAGG + Intronic
1172273278 20:33666590-33666612 GAGCAGAACTTTGAGGGCGAAGG - Exonic
1172856334 20:38006334-38006356 GAGCAAAGTTTAGGAGAAGAGGG - Exonic
1173627168 20:44481549-44481571 GACCAGAGCTGAGAGAAAAATGG + Intronic
1174930076 20:54804148-54804170 GATCAGAGCATAGAGGTGGAAGG + Intergenic
1175040511 20:56045720-56045742 AAGCAGAGCTGAAAAGAAGAGGG - Intergenic
1175681165 20:60989894-60989916 AGGCAGAGCTGAGAGGAACAGGG + Intergenic
1175925389 20:62468822-62468844 CAGCAGAGCTGGGAGGGAGATGG + Intronic
1176672234 21:9745283-9745305 GAGCAGAGGAGGGAGGAAGAGGG + Intergenic
1178235057 21:30832287-30832309 GAGCATGGCTTGGAGGTAGATGG - Intergenic
1179025064 21:37673184-37673206 GAGCAGAGGCTGGAGGAAGAGGG + Intronic
1179437973 21:41375084-41375106 GAGCAAGGCTTGGAGGAAGTGGG - Intronic
1180202048 21:46229757-46229779 CAGCAGAGGGAAGAGGAAGATGG + Intergenic
1180660014 22:17459050-17459072 GAGAAGTGCTTAGGGTAAGAAGG - Intronic
1180875303 22:19172259-19172281 GAGCAGAACTTGGGGGCAGAGGG + Intergenic
1181953714 22:26573110-26573132 GAGCAGTCCCTGGAGGAAGAAGG - Intronic
1182893717 22:33841423-33841445 GAGCAGAGCTGAGGTGGAGAGGG - Intronic
1183090461 22:35518784-35518806 GAGCAGAGAGCAGAGGAAAAGGG - Intergenic
1183292161 22:37009607-37009629 GAGCAGAGGTCAGAGAAAAATGG - Intergenic
1183516692 22:38270987-38271009 AAGAAGAGCTTCGAGGCAGAAGG - Intronic
1183646903 22:39132299-39132321 GAGCAGAGCTGCGAGGAGGGCGG + Exonic
1184049631 22:41994826-41994848 GGACAGAGTTGAGAGGAAGAAGG - Intronic
1184355914 22:43979494-43979516 GAGCAGTGCTGAGAGGAGGAAGG - Intronic
1184702156 22:46182584-46182606 CAGGAGAGCTTTGAGGATGATGG + Intronic
1184787045 22:46676954-46676976 GAACAGAGCCAAGAGGCAGAGGG - Intronic
950264773 3:11565462-11565484 GAGCAGTACTGTGAGGAAGATGG - Intronic
950362025 3:12456318-12456340 GAGAAGAGCTTAAATGAAGTAGG - Intergenic
952271761 3:31839739-31839761 GAGCAAAGCATAGAGCAATATGG + Intronic
953229921 3:41055472-41055494 AAGCAGAGCTAAGTGGGAGAAGG - Intergenic
954367406 3:50154038-50154060 GAGAAGAGGAGAGAGGAAGAGGG + Intergenic
954713103 3:52514582-52514604 GAGCAGAGGTTAGAGGTTGGAGG - Intronic
954952913 3:54490786-54490808 GAGAAGAGTTCAGAGGAAGCGGG + Intronic
956517023 3:70060924-70060946 GAGAAAAGATGAGAGGAAGAGGG + Intergenic
956573456 3:70724049-70724071 TTGCAGGGCTTATAGGAAGATGG + Intergenic
959273713 3:104248514-104248536 TAGCAAAGCTCTGAGGAAGAGGG - Intergenic
960156561 3:114302310-114302332 GAGCAGAGCCAAGAGGCAAATGG + Intronic
960245401 3:115394671-115394693 GAGCAGAGTTTACAGGCAAAAGG - Intergenic
960272507 3:115690172-115690194 GAGCAGATCTAAGTGGCAGATGG + Intronic
961599908 3:128052505-128052527 GAGCAGAGCTGAGCTGAAGCGGG + Exonic
962213107 3:133495840-133495862 GAGCAGGGCCTAGAGCAAAAAGG + Intergenic
962874259 3:139523737-139523759 GCCCAGAGCTTAGATAAAGATGG + Intronic
964235667 3:154524093-154524115 GAACAGAGCTTAGAGAAAGGAGG - Intergenic
964247678 3:154672084-154672106 AAGCAGGGCTTAGAGGAATTAGG - Intergenic
964694194 3:159488558-159488580 GGGCAGAGCTGAGAGACAGATGG + Intronic
964784297 3:160377458-160377480 GAGCAGTACTTGCAGGAAGATGG - Exonic
965571164 3:170175411-170175433 GAGGAGAGCTTAAAGCCAGAAGG + Intronic
965819501 3:172670546-172670568 GAGCAGAGCTTAAAGCAGCAAGG + Intronic
965850867 3:173021211-173021233 CAGCAGAAAGTAGAGGAAGACGG + Intronic
967266822 3:187698775-187698797 GAGCAGTGCTACGAGGAGGATGG - Exonic
967684029 3:192398884-192398906 GAGCAAGCCTCAGAGGAAGAAGG - Intronic
967703726 3:192624451-192624473 GAGCAGAGAGAAGAGGAGGAAGG + Intronic
969189332 4:5504394-5504416 GAAGAGAGCTTTGAGAAAGATGG - Intergenic
969236132 4:5866215-5866237 GAGGAGAGCAGAGAGGAAGGAGG - Intronic
969931363 4:10634206-10634228 GAGTAGAGCCTAGGGGAGGAAGG + Intronic
970695336 4:18670261-18670283 AAGCAGAGTTTAGAGGGACATGG + Intergenic
971632972 4:29018740-29018762 TTGCATAGCTTATAGGAAGAGGG - Intergenic
972669206 4:41197645-41197667 GAATAGAGCTTAGAGGATGTGGG - Intronic
972749805 4:41977360-41977382 GAGCAGACTTTAGAGAAGGAAGG - Intergenic
973734069 4:53853067-53853089 GAGAGGAGCTTTGATGAAGATGG - Intronic
975800667 4:78056980-78057002 GAGCAAAGCAGAGAGGAAGGAGG + Intergenic
975835952 4:78422379-78422401 GATAAGAGCTCTGAGGAAGAGGG + Intronic
976043406 4:80915056-80915078 AAGCAGTGCTTAGGGGAAAACGG - Intronic
978415833 4:108474915-108474937 GAGCAGAAGCAAGAGGAAGAGGG - Intergenic
979858641 4:125665839-125665861 GTTCACAGCTGAGAGGAAGAGGG + Intergenic
981434335 4:144702606-144702628 GAGCTGAGCAAAGGGGAAGAGGG + Intronic
981854183 4:149267880-149267902 GAGCAGAGCTTACAAACAGAAGG + Intergenic
982173955 4:152687953-152687975 GGGCAGAGCTTTGAGTAAAAGGG - Intronic
984713576 4:182905596-182905618 GAGCAGTGCTTTAAGAAAGAAGG - Intronic
984886579 4:184455198-184455220 GATAAGAGGTTAGAAGAAGAAGG - Intronic
985005060 4:185526120-185526142 GAGCAGGGCATGGAGGAAGATGG + Intronic
985145944 4:186894633-186894655 GAGTACAACTTATAGGAAGATGG - Intergenic
985202868 4:187502445-187502467 AAGCAGATCTTAGAAGAAGATGG + Intergenic
985402500 4:189606565-189606587 GAGCAGAGGAGGGAGGAAGAGGG - Intergenic
985780117 5:1866076-1866098 GACCAGCGCTTACAGGAAGGTGG - Intergenic
986344609 5:6823022-6823044 GAGCAGCGCGTAGAGGGTGAGGG - Intergenic
987113279 5:14707027-14707049 GAGCAGAACTTAGAAGATAAAGG + Exonic
988012237 5:25503888-25503910 AAGCAGCGCTTAGAGGAAAATGG - Intergenic
988509466 5:31853745-31853767 AACCAGAGCTTAGAGCCAGAGGG + Intronic
989113710 5:37931368-37931390 GGGGAGAGCTGAGAGAAAGATGG - Intergenic
989272432 5:39549021-39549043 GTGCAGTGCTTTGAGGAAGATGG + Intergenic
990802265 5:59618319-59618341 GACCTGAGCCAAGAGGAAGAGGG + Intronic
990963910 5:61424156-61424178 GAGCAGAAGTTAGAAGGAGATGG + Intronic
991499218 5:67259550-67259572 GAGAAGAGCTTCCAGGTAGAGGG + Intergenic
992184201 5:74227923-74227945 AAGCAGAGATGAGTGGAAGATGG + Intergenic
992542795 5:77781138-77781160 GAGCAAAGCCCAGAGGAAGATGG - Intronic
993700115 5:91109279-91109301 GAGCAGAACATAGAGAATGAAGG + Intronic
994272760 5:97801750-97801772 GGCTAGAGCTTAGAGAAAGAGGG + Intergenic
995832890 5:116373313-116373335 TATCAGAGCTTTGAGGAAGGTGG + Intronic
996077422 5:119213271-119213293 GAGCAGAAATTAGATGATGATGG - Intronic
996674760 5:126161194-126161216 GAGCATAACTTAGAAGAATAAGG + Intergenic
998798479 5:145843678-145843700 GAGCACAGCTTTGAGGAGGGTGG + Intergenic
998878540 5:146624499-146624521 GAGCATGGCTTAGACTAAGATGG - Intronic
999411844 5:151357032-151357054 TAGCAAATCTAAGAGGAAGAAGG + Intergenic
999685364 5:154097924-154097946 TCCCAGAGCTCAGAGGAAGAAGG + Intronic
999816943 5:155186512-155186534 GATAAGAGTTTAGAGGTAGAGGG + Intergenic
1000111649 5:158113781-158113803 GAGTAGGGCTTTGGGGAAGAAGG - Intergenic
1001379266 5:171292659-171292681 CAGAAGAGCTTAGAGGTAGGAGG + Intronic
1002955080 6:1854218-1854240 TAACAGAACTTAGAGAAAGATGG + Intronic
1003266897 6:4573940-4573962 GAGGAGAGGAAAGAGGAAGAAGG - Intergenic
1004204564 6:13580197-13580219 GAGAAGAGGTTAGAGAAACATGG - Intronic
1004250119 6:14016625-14016647 GAGCAGAGCCTGGAGGGAGCCGG - Intergenic
1004436966 6:15605415-15605437 GAGAAGAGGTTTGAGTAAGATGG - Intronic
1007598493 6:43066722-43066744 GAAGAGAGATTAGAGGAACAAGG - Intronic
1008496133 6:52136270-52136292 GAGCAGAGATAAGAGGAGGCAGG + Intergenic
1009661476 6:66617576-66617598 GAGGAGATCTTAGTGGAAGTAGG + Intergenic
1010658130 6:78536764-78536786 CAGAAGAGCTTGGAGGCAGAAGG + Intergenic
1011325157 6:86142644-86142666 AAGCAGAGGTTGGAGAAAGAGGG + Intergenic
1011369821 6:86624069-86624091 CAGCAGAGGTCAGAGGAAAATGG - Intergenic
1011722774 6:90176295-90176317 GAGCAGAGATTAGTGAAGGAGGG + Intronic
1011943575 6:92872484-92872506 GTTCAGAGCTTAGAGAAAGTGGG - Intergenic
1013176485 6:107681912-107681934 GAACAAAGAGTAGAGGAAGAAGG - Intergenic
1014631009 6:123789907-123789929 GAGCAAAGTCTAGAGGAAAATGG + Intergenic
1014875500 6:126654362-126654384 GTGGAGGGCTCAGAGGAAGACGG + Intergenic
1015815460 6:137206415-137206437 GAGCAGAGCTAAGAATAGGATGG + Intronic
1017846206 6:158260710-158260732 GAGCAGTGAGTAGAGGATGAGGG + Intronic
1017989689 6:159475394-159475416 GAGCAGAACTGGGAGGAAGTTGG - Intergenic
1018749911 6:166795534-166795556 CAGAAGAGCTTAGAGAATGAAGG - Intronic
1019579022 7:1750984-1751006 GGGCCGAGCTCAGAGGAAAAGGG + Intergenic
1020788262 7:12594690-12594712 GAGGTGAGGGTAGAGGAAGAAGG + Intronic
1021359909 7:19699571-19699593 GAGCCAAGTTTAAAGGAAGAAGG - Intronic
1022191291 7:28019025-28019047 GAGGAGAGGTTAGAGAAACAGGG - Intronic
1022714661 7:32888981-32889003 GCGCAGAGGTGAGAGGAAAAAGG - Intronic
1023641986 7:42268378-42268400 GAGAAGGCCTTAGAGGAAGGAGG - Intergenic
1026257154 7:68722294-68722316 GTGCAGCGTTTACAGGAAGAAGG + Intergenic
1026910966 7:74091782-74091804 GAGCAGTGTTTAGAGGATGTCGG + Intronic
1027603671 7:80272125-80272147 AAGAAGAAATTAGAGGAAGAAGG + Intergenic
1028009419 7:85621889-85621911 GACCACAGCTTTGAGGAAAATGG - Intergenic
1029846277 7:103415312-103415334 GAGCAAAACCTGGAGGAAGAGGG - Intronic
1030359231 7:108578044-108578066 GAGAAGATCTATGAGGAAGAGGG + Intergenic
1031185791 7:118478289-118478311 GAGCAAGACTTAGAGGAGGAGGG + Intergenic
1031823632 7:126534963-126534985 GAGCAGAGCCCTGAGGAATAAGG + Intronic
1031923507 7:127618171-127618193 GAGCAGAGGAGAGAGGAGGAGGG + Intergenic
1032417305 7:131745947-131745969 GATGAGAGCTGAGAGGAAGAAGG + Intergenic
1032509958 7:132464901-132464923 TATCAGAGCTTTGAGGAAAATGG - Intronic
1034263748 7:149772097-149772119 GAAAAGAGCTGAGAGGAGGAGGG - Intronic
1034550916 7:151820148-151820170 GAGCAGAAGTGAGAGGAGGAAGG + Intronic
1034963823 7:155379039-155379061 GAAGAGAGCTTAGACCAAGAAGG + Intergenic
1035645171 8:1213641-1213663 GATCAGAGCCCAGAGAAAGACGG - Intergenic
1038888396 8:31691065-31691087 TAGCAGAGATTAGGGTAAGAAGG + Intronic
1039135443 8:34317825-34317847 GAGCAGAGGAGAGAGGATGAGGG - Intergenic
1039972081 8:42328567-42328589 GAGCTGAGGTTAGAAAAAGACGG + Intronic
1041649921 8:60292208-60292230 GAGCTGAGGTCATAGGAAGAAGG + Intergenic
1041698460 8:60762185-60762207 GAGCAGTAGTTAGAGGAAGATGG - Intronic
1042479446 8:69286838-69286860 GAGGAGAGCATTGAAGAAGAGGG + Intergenic
1044268550 8:90212094-90212116 GATCTGAGCTTATGGGAAGAAGG - Intergenic
1044941820 8:97351202-97351224 AAGCAGAACTTAGAAGACGAGGG - Intergenic
1045426059 8:102066909-102066931 GGGTAGAGCTTAGAGGAAGCTGG - Intronic
1045582287 8:103495296-103495318 GAGCAAAAATTTGAGGAAGAGGG + Intergenic
1047102787 8:121696527-121696549 GCATAGAGCTTAAAGGAAGAAGG - Intergenic
1047403211 8:124563044-124563066 GAGCAGTGGTAAGAGGAAGGAGG + Intronic
1048029270 8:130615706-130615728 CAGCAGAGCTGAGAGGGAAAAGG - Intergenic
1048139802 8:131783296-131783318 GAGATGAGCTTAGAGGATCATGG - Intergenic
1048845990 8:138604167-138604189 GACTAGAGCTTAGAGAAGGAGGG + Intronic
1048924093 8:139255016-139255038 TAGCAGAGCTTAAAGGAAAAGGG + Intergenic
1049399917 8:142420484-142420506 GATCTGAGCTCACAGGAAGATGG + Intergenic
1050246973 9:3700789-3700811 GGGCAGAGCAAAGAGGAAAAGGG - Intergenic
1050284241 9:4084559-4084581 AAACAGAGCTGTGAGGAAGAAGG + Intronic
1051010356 9:12405615-12405637 GAGCAGAGTTCAGAGGAATCTGG - Intergenic
1051166803 9:14271169-14271191 GAGTAGAGGTTAGGGGGAGAGGG - Intronic
1051901984 9:22053007-22053029 GAGAAAATGTTAGAGGAAGAGGG + Intergenic
1052035922 9:23680743-23680765 GACCAGACCTCAGAGCAAGATGG - Intergenic
1052163897 9:25297827-25297849 GAACAAAGCTTAGAGAAACATGG - Intergenic
1055244125 9:74219903-74219925 GAGGTGAGTTTGGAGGAAGATGG + Intergenic
1056773152 9:89494277-89494299 GAGGAGAGGGAAGAGGAAGAGGG - Intronic
1057722681 9:97545612-97545634 CTGCAGAGCTAAGAGGAGGACGG - Intronic
1058711419 9:107682333-107682355 GTGAAGAGGTGAGAGGAAGAGGG + Intergenic
1058833616 9:108841177-108841199 GAGCAGAGCCATGAGGCAGAAGG - Intergenic
1059636888 9:116179967-116179989 AAGCAGAGGTGAGAGGATGAGGG - Intronic
1060243067 9:121921386-121921408 GAACAGAGCTTCAAGGAAGAGGG + Intronic
1061282030 9:129602914-129602936 GAGGAGAGGGGAGAGGAAGAGGG + Intergenic
1061772267 9:132934996-132935018 GGCCAGTGGTTAGAGGAAGATGG - Intronic
1061909062 9:133713241-133713263 GAGCAGGGCCTAGAGGAGGGAGG - Intronic
1062552600 9:137096731-137096753 GAGCAGAGAGCAGAGGGAGAGGG + Intronic
1186280913 X:7992104-7992126 CAGTAGAGATTGGAGGAAGAAGG + Intergenic
1187039673 X:15580315-15580337 GAGGAGAGCTCTGAGGCAGAGGG - Intronic
1188584231 X:31752755-31752777 AAGCTGAGCTAAGGGGAAGATGG - Intronic
1189542039 X:42002041-42002063 AAGAGGAGCTTAGAAGAAGAGGG - Intergenic
1190931756 X:54954636-54954658 CAGTCCAGCTTAGAGGAAGAAGG - Intronic
1192315366 X:70047451-70047473 GAGCAGAGCCTAAAGGAAACTGG - Intronic
1193075023 X:77346516-77346538 TAGCAGAGGCTAGAGGAGGAGGG + Intergenic
1194138848 X:90182273-90182295 TAGCAGAGTTTAGAGAAAGCAGG - Intergenic
1194474676 X:94344046-94344068 AAGAAGATGTTAGAGGAAGAAGG + Intergenic
1194731594 X:97461779-97461801 CAGAAAAGCCTAGAGGAAGATGG - Intronic
1194813054 X:98409789-98409811 GAGCACAGCTCAAAGAAAGAGGG - Intergenic
1195045633 X:101052085-101052107 GAGGAGAACTTAGAGAAGGAAGG - Intronic
1195480417 X:105338511-105338533 GAGGAGAGAATAGTGGAAGAGGG - Intronic
1196873451 X:120135306-120135328 GAATAGAAATTAGAGGAAGATGG + Intergenic
1196991747 X:121336724-121336746 GAGCAGAAAGAAGAGGAAGAAGG + Intergenic
1198788763 X:140319256-140319278 GAGCAGAGGTTAGAGATGGATGG + Intergenic
1198882712 X:141298543-141298565 GAGCAGAGGTCAGAAGAAGCTGG - Intergenic
1198988948 X:142489090-142489112 GAGAAGAGCTAAGAGAAAGAGGG - Intergenic
1199542694 X:148974735-148974757 GAGCAGTGCAAAGAGAAAGATGG - Intronic
1199864970 X:151837312-151837334 CATCAGAACATAGAGGAAGAGGG + Intergenic
1200484651 Y:3752506-3752528 TAGCAGAGTTTAGAGAAAGCAGG - Intergenic
1200750690 Y:6941718-6941740 GAGCAGAGCTTATGGGAAGATGG + Intronic
1200751167 Y:6945367-6945389 GAGCAGGGCATGGAGGACGAGGG - Intronic
1201458693 Y:14199148-14199170 GAGCAGATCTTACAGGGAAATGG - Intergenic
1201901671 Y:19049997-19050019 GAGCAGAGCCTGGAGCAACAGGG + Intergenic