ID: 900804180

View in Genome Browser
Species Human (GRCh38)
Location 1:4756530-4756552
Sequence TAGGGCAGAACAGAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900804172_900804180 24 Left 900804172 1:4756483-4756505 CCAAGCTAAGCTCTTTCTCTCCA 0: 1
1: 0
2: 0
3: 22
4: 292
Right 900804180 1:4756530-4756552 TAGGGCAGAACAGAGATGGCTGG 0: 1
1: 0
2: 2
3: 19
4: 263
900804174_900804180 4 Left 900804174 1:4756503-4756525 CCAACTCACAAATGTTTACGGAG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 900804180 1:4756530-4756552 TAGGGCAGAACAGAGATGGCTGG 0: 1
1: 0
2: 2
3: 19
4: 263
900804171_900804180 25 Left 900804171 1:4756482-4756504 CCCAAGCTAAGCTCTTTCTCTCC 0: 1
1: 0
2: 2
3: 31
4: 300
Right 900804180 1:4756530-4756552 TAGGGCAGAACAGAGATGGCTGG 0: 1
1: 0
2: 2
3: 19
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900804180 Original CRISPR TAGGGCAGAACAGAGATGGC TGG Intronic
900804180 1:4756530-4756552 TAGGGCAGAACAGAGATGGCTGG + Intronic
901802892 1:11719470-11719492 TAGGGCAGAATAATGAAGGCAGG + Intronic
905297974 1:36966430-36966452 TTTGCCAGGACAGAGATGGCTGG + Intronic
905329378 1:37181632-37181654 TAGGGGAGCCCAGAGAAGGCAGG - Intergenic
908907922 1:69037862-69037884 TGGGGCAGAAAAGAGAGTGCAGG + Intergenic
911393353 1:97274371-97274393 GAGGGCACAAGAGAGATGCCAGG - Intronic
912494617 1:110083619-110083641 TACTCAAGAACAGAGATGGCTGG + Intergenic
912971433 1:114287293-114287315 TTGGGCAGAACTGAGGTAGCAGG - Intergenic
914878540 1:151530134-151530156 CAGGGCTGAGCAGAGAGGGCTGG - Intronic
915557509 1:156668697-156668719 TAGTACAGGAGAGAGATGGCGGG - Intergenic
915859053 1:159422608-159422630 TAGGGCAGGACAGAGACTGGTGG + Intergenic
916492764 1:165316318-165316340 GAGGGCAGAGCAGAGAGGCCTGG + Intronic
917212411 1:172644207-172644229 AAGGGCAGATCAGAGGTGGATGG + Intergenic
919060441 1:192625326-192625348 TGGGGCAGAACAGTGAATGCAGG - Intergenic
920656045 1:207875861-207875883 GAGGGCAGTAGAGAGATGGAGGG - Intergenic
921271707 1:213475803-213475825 TATGGCGGAAAAGAGATGGTGGG + Intergenic
1063042790 10:2359962-2359984 TAGACCAGAACAGAGGTGGGAGG - Intergenic
1063042795 10:2359986-2360008 TAGACCAGAACAGAGGTGGGAGG - Intergenic
1067059268 10:43069564-43069586 TGGGGCAGAGGAGAGAGGGCTGG + Intergenic
1069879816 10:71584917-71584939 CAGGGCAGATCAGAGAGGGGTGG + Intronic
1071336412 10:84604095-84604117 AAGGGCAGACCAGAGACTGCAGG - Intergenic
1071436829 10:85655200-85655222 CAGGGCACAGCAGAGAAGGCAGG - Intronic
1072138125 10:92566277-92566299 CAGGGGAGTACTGAGATGGCAGG + Intronic
1073008340 10:100341378-100341400 AAGGCCAGGAGAGAGATGGCTGG + Intergenic
1074431787 10:113400806-113400828 CAGGGCAGAAGAGGGAGGGCAGG + Intergenic
1074957272 10:118404424-118404446 AAGGGAAGAACAGAGACGGGGGG - Intergenic
1075207587 10:120460402-120460424 TAGTGTAGAAATGAGATGGCTGG + Intronic
1075537801 10:123285690-123285712 AAAGGCAGAGCAGAAATGGCAGG - Intergenic
1075901915 10:126049973-126049995 CAGGGCAGAAAGGAGGTGGCTGG + Intronic
1076736314 10:132460769-132460791 TCGGCCAGCACAGAGATGGACGG + Intergenic
1077191097 11:1256223-1256245 TAGGTAAGTACAGGGATGGCTGG + Exonic
1077261614 11:1624753-1624775 AGGGGCAGAACGGAGGTGGCTGG + Intergenic
1077957061 11:7031705-7031727 GACGGCAGAACACAGGTGGCGGG - Intronic
1078259309 11:9689845-9689867 CAGGGCCCAACAGAGATGACAGG - Intronic
1079962704 11:26943710-26943732 TAGGGCAGAACTAAGATTGGTGG - Intergenic
1081484014 11:43514169-43514191 TAGGTCAGTAAAAAGATGGCTGG - Intergenic
1081573007 11:44303119-44303141 AAGGCCACAACAGAGAAGGCTGG - Intronic
1081757689 11:45556390-45556412 GATGGCAGAACAGTGATGGATGG - Intergenic
1083310093 11:61779572-61779594 TAGGGGTGAGCAGGGATGGCAGG + Intronic
1083921788 11:65785248-65785270 TTGGGGAGAACAGAGTTGGGGGG - Intergenic
1085403047 11:76245955-76245977 GAGGGGAGAGCAGAGAAGGCTGG + Intergenic
1085464947 11:76716903-76716925 TGGGGCAGCCCAGAGAGGGCTGG + Intergenic
1087549924 11:99636432-99636454 TAGGCCAGAACAGAAAAGGGTGG - Intronic
1088776100 11:113084777-113084799 TTGGGCAGAAGTTAGATGGCTGG - Intronic
1091928719 12:4377231-4377253 TAGGGTAGAACAGAACAGGCCGG - Intronic
1093149088 12:15600894-15600916 TAGGGCTGGGCAGAGCTGGCCGG - Intergenic
1093244438 12:16718958-16718980 TAGGGCAGAAGAGAGCCGACTGG + Intergenic
1093857430 12:24123047-24123069 GAGAGCAGAACAGTCATGGCAGG + Intergenic
1094207862 12:27859684-27859706 TAGGGCAGGCCAGAAATGTCAGG + Intergenic
1096079656 12:48825047-48825069 GAGGGCAGAACAGAGAGGGGAGG + Intronic
1096153492 12:49329286-49329308 TAGGGGAGAAAGGAGATGGATGG + Intronic
1096282227 12:50266091-50266113 GAGGGCAGACAAGAGCTGGCAGG - Intronic
1097078079 12:56409952-56409974 TAGAACAGCACAGAGAAGGCCGG + Intergenic
1099375865 12:81895609-81895631 TCAGGCAGAAAACAGATGGCAGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1103244833 12:119447620-119447642 TAGGTAATAACAGGGATGGCAGG + Intronic
1103521776 12:121540885-121540907 GAAGGCAGGGCAGAGATGGCAGG + Intronic
1103883018 12:124180913-124180935 TAAGCGAGAACAGAGATTGCAGG + Intronic
1104278536 12:127352782-127352804 TAAGGGAGTAGAGAGATGGCTGG - Intergenic
1104411496 12:128561962-128561984 TGGGGCAGAGAAGAGATGGGTGG + Intronic
1105945848 13:25188786-25188808 TGGGGCAGGACAGGAATGGCTGG + Intergenic
1107035388 13:35897025-35897047 TAAGGCAGAACAGAGAGTGTGGG + Intronic
1108363260 13:49686724-49686746 CAGGGCAGAAGAGAGAGTGCTGG - Intronic
1108416773 13:50205554-50205576 TAGGGAAGAACAGGGCTGACTGG - Intronic
1109470671 13:62799710-62799732 TAGAGCTGAAAAGAGATGACAGG + Intergenic
1111194136 13:84850442-84850464 TAAGGCTGCACAGACATGGCTGG - Intergenic
1113884833 13:113653088-113653110 CAGGGCAGGACAGGGCTGGCAGG - Intronic
1114356756 14:21918243-21918265 TTGGGAAGAACAATGATGGCAGG + Intergenic
1114539475 14:23443986-23444008 AAGGGCAGAGCAGAGAGGGGAGG + Intergenic
1118821430 14:69348788-69348810 TAGCACAGAAGAGAGCTGGCTGG - Intronic
1119592952 14:75907411-75907433 TAGGGCAGAACAAAGAGGAAAGG - Intronic
1121184567 14:91955145-91955167 AAGAACAAAACAGAGATGGCAGG - Intergenic
1122371104 14:101229478-101229500 TAGGGGAGCACACAGAGGGCAGG + Intergenic
1123509283 15:20979931-20979953 AAGGGCAGAAGGGAGATGGAGGG - Intergenic
1123566507 15:21553678-21553700 AAGGGCAGAAGGGAGATGGAGGG - Intergenic
1123602768 15:21990964-21990986 AAGGGCAGAAGGGAGATGGAGGG - Intergenic
1124383912 15:29190401-29190423 AAGGGCAGAACAGAGATCCAGGG + Intronic
1124853764 15:33366942-33366964 TAGGGGAAAACAGGGATGTCTGG + Intronic
1125491248 15:40150178-40150200 TGGGGCAGAAGAGACATGGTTGG - Intergenic
1125530795 15:40412247-40412269 TGGGGCAGAAGAGAGAAGGATGG + Intronic
1126111483 15:45177651-45177673 TAGGGGAGATCAGAGAGGACAGG - Intronic
1127130406 15:55856284-55856306 CAGGGCAGAAGAGAGAAGGCTGG + Intronic
1127620512 15:60729205-60729227 TGGAGCAGAACAGAGGTGGGAGG - Intronic
1128131245 15:65228503-65228525 TAGGGCACCACACAGAAGGCAGG + Intergenic
1128144663 15:65326251-65326273 AATGGCAGAACAGAGAGGCCTGG + Intergenic
1129252343 15:74315931-74315953 GAGGGCAGTACAGAGATGCCTGG - Intronic
1202974871 15_KI270727v1_random:280766-280788 AAGGGCAGAAGGGAGATGGAGGG - Intergenic
1132860820 16:2070937-2070959 GAGGGCAGAGCTGAGACGGCAGG + Intronic
1132860829 16:2070971-2070993 GAGGGCAGAGCTGAGAGGGCAGG + Intronic
1133730748 16:8576535-8576557 TGGAGCAGGACAGAGGTGGCAGG + Intronic
1135773961 16:25239863-25239885 CAGGGCAATACAGAGATGGAGGG + Exonic
1138520998 16:57570800-57570822 CAGGGCAGGACAGAGGAGGCGGG - Intronic
1138653606 16:58476239-58476261 AAGGGGAGAACAGATATGGGGGG + Intronic
1139265424 16:65634226-65634248 AAAGGCAGGACAGGGATGGCTGG - Intergenic
1141206277 16:81935347-81935369 TATGGCAGAACAGACTTTGCAGG - Intronic
1141333067 16:83129673-83129695 CAGGGCAGACCAGATATGCCAGG - Intronic
1141377931 16:83548805-83548827 TAGGGCAGAAAAAAGAGGGGTGG - Intronic
1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG + Intergenic
1141675672 16:85515978-85516000 AAGGGCAGAGAGGAGATGGCAGG + Intergenic
1141835769 16:86538299-86538321 TTGGGCAGAACAGAGCTTCCAGG + Intronic
1142344939 16:89547907-89547929 CAAGGGAGAACAAAGATGGCCGG - Intronic
1144418452 17:15073556-15073578 TAGGACAGGACAGAGATGTGGGG - Intergenic
1144643699 17:16954096-16954118 GAGGGAAGACCAGAGGTGGCTGG + Intronic
1144767199 17:17739302-17739324 GAGGGGAAGACAGAGATGGCTGG + Intronic
1145205091 17:20980287-20980309 GAGGGAAGACCAGAGGTGGCTGG - Intergenic
1146032337 17:29376951-29376973 AAGAACAGAACACAGATGGCTGG + Intergenic
1146518079 17:33504948-33504970 TGTGGCAGAACTGAGATGGGTGG + Intronic
1146587132 17:34092045-34092067 TGGGGAAGAAAAGAGATGCCAGG + Intronic
1148533125 17:48414432-48414454 GAGGGCAGAACACAGAGGTCAGG + Intronic
1148562865 17:48616142-48616164 CAGGGCAGGGCAGAGAGGGCAGG - Intronic
1152343593 17:79738379-79738401 CAGTGGAGCACAGAGATGGCAGG - Intronic
1152846100 17:82600691-82600713 GTGGGCAGAACAGAGACTGCTGG - Intronic
1154193674 18:12250800-12250822 CAGGGCTGGACAGAGAGGGCGGG + Intergenic
1155524425 18:26702086-26702108 GAGGGCAGAGCAGAGTAGGCTGG + Intergenic
1156470870 18:37376588-37376610 TATGGCAGAACAGAAATGGAGGG - Intronic
1156596152 18:38550565-38550587 TAGGGAAGGAGAGAGGTGGCTGG - Intergenic
1156739458 18:40305727-40305749 CAGGCCAGAACTGAGATGGAAGG - Intergenic
1156828165 18:41458199-41458221 TACAGCAAAACAGAGATTGCCGG + Intergenic
1157539757 18:48492223-48492245 TTGGGGAGAACAGTGATGACTGG - Intergenic
1157648586 18:49303616-49303638 TAAGGCTGAAAAGAGAGGGCAGG + Intronic
1158140174 18:54247095-54247117 TGGGGAAGAACAAAGATGGGGGG - Intergenic
1158350871 18:56563488-56563510 TTGGGCAGAAAAGAGTTGGCAGG + Intergenic
1159873008 18:73779427-73779449 TAGGGCAGAACAGAGACACCAGG + Intergenic
1159896551 18:74002117-74002139 CAGGGCAGATAAGAGAGGGCTGG - Intergenic
1160092496 18:75840277-75840299 CAGGCCAGAAGAGAGAAGGCAGG - Intergenic
1160353620 18:78207154-78207176 TAGGGCATAAAAGAGAACGCAGG + Intergenic
1160900804 19:1427327-1427349 TCGCGCAGAACAGTCATGGCTGG - Intronic
1162780790 19:13006152-13006174 GTGGGAAGAACAGAGCTGGCCGG + Intronic
1162959297 19:14116992-14117014 AAGGGCAGGAGAAAGATGGCGGG + Intronic
1163799258 19:19355058-19355080 TAGGGCAGAACAGGGCTGGCTGG - Intronic
1164484838 19:28646290-28646312 AAGGGCAGAACATATATGGTAGG + Intergenic
1164767704 19:30784458-30784480 CAGGGCAGGACAGAGATCCCTGG - Intergenic
1164862656 19:31574710-31574732 TAGGGCAGACCAGAGGTGCGGGG + Intergenic
1165341185 19:35213361-35213383 TAGGGCTGAAAAAAGAAGGCAGG + Intergenic
1166023413 19:40055031-40055053 TAGGGAAGAATGGAGATGGTTGG - Intronic
1166381886 19:42359005-42359027 TAGGGAAGTACAGGGGTGGCTGG + Intronic
1167267074 19:48488541-48488563 GAGGGCTGAGGAGAGATGGCAGG - Intronic
1167428712 19:49442592-49442614 AAGGACAGAACTGAGAGGGCGGG - Intergenic
1167652257 19:50738784-50738806 GAGGGAAGAACAAGGATGGCAGG - Intergenic
925731022 2:6919187-6919209 TGGGGCAGGTCAGAGGTGGCAGG + Intronic
926918893 2:17919709-17919731 CAGCGCAGAACAGACCTGGCAGG + Intronic
927374314 2:22395895-22395917 TGGGGAAGAACAGAGATTTCTGG - Intergenic
928599384 2:32888235-32888257 TGGGGCAGAAGAGAGATGTTTGG + Intergenic
929904866 2:46036847-46036869 TAATGCAGAAGAGAGATGTCGGG + Intronic
931145988 2:59519005-59519027 TAGGGCACAACAGAAACGGGAGG + Intergenic
931838210 2:66122155-66122177 CAGGGCAGAGCAGAGAAGACTGG + Intergenic
932779464 2:74550879-74550901 TATGGCAGCACAGACAGGGCGGG - Intronic
933553608 2:83806001-83806023 TAGGGCAGAAAGGAGACGTCTGG - Intergenic
934155558 2:89196695-89196717 CAGGGCAGAACACACATGGAAGG + Intergenic
934211766 2:89986064-89986086 CAGGGCAGAACACACATGGAAGG - Intergenic
936647054 2:114384207-114384229 TAGTCCAGAAGAAAGATGGCAGG + Intergenic
936941568 2:117889627-117889649 TAGGTCAGCAGAGAAATGGCTGG + Intergenic
936951955 2:117986507-117986529 TAGGGAAGAAGAGAGATGTGGGG - Intronic
937064324 2:119005866-119005888 CTGGGCAGGACAGAGATGGTAGG + Intergenic
938407722 2:131041791-131041813 TGGGGCAGAACAGAGATGGAAGG - Intronic
944265159 2:197716680-197716702 TACAGAAGAACAGAGATGGTAGG - Intronic
945066846 2:205954841-205954863 TGGGGCAGAACACAGGGGGCGGG + Intergenic
946443493 2:219717433-219717455 TAGGGCAGAAAAAATATGGAAGG + Intergenic
948266325 2:236637713-236637735 TGGGGCAGAGCTGAGATGCCTGG - Intergenic
948319707 2:237059696-237059718 GAGGCCAGAACACAGTTGGCAGG - Intergenic
1169282734 20:4280867-4280889 CAGGGGAGAGCAGAGAGGGCAGG + Intergenic
1169473665 20:5911255-5911277 TAGTGCAGATCTGAGATGGTAGG - Intergenic
1171148378 20:22805329-22805351 TAAGGCAGCACAGAAAGGGCTGG + Intergenic
1171461692 20:25301646-25301668 CAGGGCAGTACAGAGGAGGCCGG + Intronic
1173650305 20:44659550-44659572 TAGGGCAGAAGACAGAAGGGTGG - Intergenic
1174301858 20:49588229-49588251 GAGGGAAGAGCAGGGATGGCAGG - Intergenic
1174408144 20:50316291-50316313 CAGGTCAGAACAAAGATGCCTGG - Intergenic
1174470363 20:50755204-50755226 AAAGGCAGAACAGAGAGGTCTGG - Intronic
1174497883 20:50961850-50961872 GAGTGGAGAACAAAGATGGCTGG + Exonic
1175194273 20:57231605-57231627 CAGTGGAGAACAGAGATGGTTGG - Intronic
1175514666 20:59561342-59561364 TAGGGCAGAACAAGGGTGGTAGG + Intergenic
1176020358 20:62959528-62959550 TCGGGCAGAGCAGAGACGCCAGG + Intronic
1178489481 21:33039857-33039879 TTGGGTAGAACAGACATGGCTGG - Intergenic
1178989552 21:37341478-37341500 TTGGGCAGAACAGAAAAGGAAGG - Intergenic
1179961329 21:44768399-44768421 AAGGGCAGAACAGACATGCCTGG + Intergenic
1184532035 22:45062217-45062239 TGGGGCAGAGCAGAGCTGGCTGG + Intergenic
1185031828 22:48447932-48447954 TAGGGCAGAACACAGTTGTCTGG - Intergenic
1185320188 22:50197160-50197182 AATGGCAGAACTGGGATGGCAGG - Intronic
950861513 3:16151374-16151396 TAGAGCTAAACATAGATGGCTGG - Intergenic
950980507 3:17299255-17299277 CAGGGCAGAACAGAGTGGGGTGG + Intronic
951702436 3:25509871-25509893 TAAGGCAGAGGAGAGATGGAAGG - Intronic
952392953 3:32896514-32896536 TAGGGCAGAAGAGAGGTGGGAGG - Exonic
953805546 3:46064725-46064747 TGGGGCTGAGCAGAGAAGGCTGG - Intergenic
954798448 3:53173356-53173378 TAGGTCAGGCCAGAGAAGGCAGG - Intronic
954989832 3:54831208-54831230 TAGGGCTGAGCAGATCTGGCAGG + Intronic
960221021 3:115108430-115108452 TAGGGGAGCACAGAGATGAGAGG + Intronic
963563847 3:146902594-146902616 TAGGGGAGAAAAGATATGCCAGG + Intergenic
964066331 3:152584303-152584325 TTGTGCAGAACAGAGAGGGGTGG - Intergenic
966033946 3:175386726-175386748 TCAGGCAGAACAGAGCTGGAAGG - Intronic
968609302 4:1549869-1549891 TCGGGGAGAAGAGTGATGGCCGG + Intergenic
969862300 4:10047140-10047162 AAGAGGAGAACAGAGAGGGCTGG - Intronic
971356692 4:25901415-25901437 TGGGGCAGATGAGAGATGTCAGG - Intronic
973262234 4:48176891-48176913 AAGGGGAAAACAGAGCTGGCTGG - Intronic
975318608 4:72983396-72983418 TAGGGGACAAGAGAGATGGAAGG + Intergenic
975631073 4:76402838-76402860 TAGGGCAGACCAAGGAAGGCAGG + Intronic
977092411 4:92694416-92694438 TAGCGCTGAACACAGATGGAAGG - Intronic
978784223 4:112591638-112591660 TGGGGCAGAAGAATGATGGCTGG - Intronic
978825391 4:113016479-113016501 TGGAGCAGAGAAGAGATGGCAGG - Intronic
983096733 4:163571291-163571313 TCTGGCAGGACAGAGATGGAGGG - Intronic
984034613 4:174649767-174649789 GAGTTCAGGACAGAGATGGCTGG + Intronic
984069509 4:175093912-175093934 GATGGCTGCACAGAGATGGCGGG + Intergenic
985131752 4:186745538-186745560 CAGGGCAGTGCAGTGATGGCAGG + Intergenic
985181952 4:187274119-187274141 TAGGGCAGCGTACAGATGGCAGG + Intergenic
985556393 5:560443-560465 GAGGGCTGGACACAGATGGCAGG - Intergenic
985737276 5:1591504-1591526 TAGGGAAGAAAAGGGATTGCTGG - Intergenic
985913855 5:2903131-2903153 CAGGGCAGAAAGCAGATGGCAGG - Intergenic
986999315 5:13643219-13643241 GAGGGAAGAATAGAGATGGAAGG - Intergenic
987426957 5:17784452-17784474 TATGGCAGAAGAGATATGGAAGG - Intergenic
989721763 5:44537316-44537338 TTTGGCAGACCAGAGATGTCAGG - Intergenic
991930511 5:71749149-71749171 AAGGGCAGGAGAGAGAGGGCTGG + Intergenic
994490329 5:100434783-100434805 TAGAGCAGGACAAAGATGGGTGG - Intergenic
996349124 5:122519031-122519053 GAGGACACAACAGAGATGCCTGG + Intergenic
996841968 5:127856753-127856775 TATGGGAAAACAGAGATGGTTGG + Intergenic
996962183 5:129264406-129264428 TAGGGGAAAAAGGAGATGGCTGG - Intergenic
997124368 5:131211131-131211153 TATGAAAGAATAGAGATGGCAGG - Intergenic
999808001 5:155101801-155101823 CAGGGCACAGCAGAGATGGCTGG + Intergenic
1002526512 5:179818653-179818675 CAGGGCAGGACAGAGACTGCAGG - Intronic
1003219013 6:4140468-4140490 TTGTGCAGAACAGAGAAGGCAGG - Intergenic
1003848461 6:10198102-10198124 TAGGGAAGAACTGGGTTGGCTGG - Intronic
1004037936 6:11942377-11942399 TAGGGAGGATCAGAGATAGCAGG + Intergenic
1004060949 6:12197595-12197617 TAGAGCAGAAGGGAGATGGCAGG + Intergenic
1004843668 6:19614767-19614789 TACAGCAGCACAGAGCTGGCTGG + Intergenic
1006070536 6:31495025-31495047 TGGGGCAGAGCAGAGGGGGCTGG + Intronic
1006081951 6:31572904-31572926 TAGGGGAGAACAGAGTTGAGGGG - Intronic
1006245060 6:32726107-32726129 CAGGCCAGTAGAGAGATGGCAGG + Intergenic
1006672409 6:35737569-35737591 TAGGGCAGAAAAGGGATGGGGGG - Intronic
1012600172 6:101086789-101086811 CAGAGCAGAGCAGAGAAGGCTGG + Intergenic
1014818901 6:125963629-125963651 TGGGGCAGAGCAGAGGTGGCAGG + Intronic
1017021895 6:150146689-150146711 TAGGCCAGAACAGATCTGGGAGG + Intronic
1017784781 6:157746610-157746632 TGGGGCAAGACAGAGATGGAGGG + Intronic
1017896862 6:158687433-158687455 TAGGGCATAGCAGAAATGACAGG - Intronic
1018753882 6:166831319-166831341 CTGAGCAGAAGAGAGATGGCAGG - Intronic
1018903021 6:168060567-168060589 GCCGGAAGAACAGAGATGGCAGG - Intronic
1019496776 7:1344454-1344476 AAGGCCAGGACAGAGATGGATGG + Intergenic
1022214175 7:28241699-28241721 AAAGGCAGACAAGAGATGGCAGG + Intergenic
1022529539 7:31058217-31058239 TTGGACAGTACAGGGATGGCTGG + Intronic
1023913212 7:44569673-44569695 CAGGGCAGAACAAGGATGGATGG + Intronic
1023986157 7:45097729-45097751 GAGGGCAGAACAGATAGGGCAGG + Intergenic
1024567964 7:50698557-50698579 CACGGCAGAACAGAGATTACAGG - Intronic
1029503868 7:100950329-100950351 CAGGGCAGAAGAGAGAAGCCTGG - Intronic
1030270607 7:107664807-107664829 TGGGGCAGAAACGAGATGGTGGG - Intronic
1031120625 7:117717544-117717566 CAGGGCAGAACAGAGTAGGATGG - Intronic
1032413865 7:131720958-131720980 TAGGGCAGAATAGAGAATGGAGG - Intergenic
1033728691 7:144150386-144150408 TAAGGCACAACAGAGATTGTTGG - Intergenic
1034455273 7:151166980-151167002 TAGGGCCGACCAGGGCTGGCGGG - Intronic
1035132189 7:156665710-156665732 GAGTGCAGAATCGAGATGGCTGG - Intronic
1036766931 8:11555303-11555325 TAGGGAAGAAAAGACAGGGCTGG - Intronic
1037216987 8:16467096-16467118 AAGGACAGGACAGAAATGGCTGG + Intronic
1037695941 8:21223996-21224018 TTGGGTAGAAAACAGATGGCTGG + Intergenic
1038395623 8:27243615-27243637 CAGGGAAGAACACAGCTGGCAGG - Intronic
1039249859 8:35650800-35650822 TGGGCCAGTACAGAGAAGGCAGG + Intronic
1040396022 8:47001033-47001055 TAGGACAGGCCAGAGCTGGCTGG - Intergenic
1040414532 8:47184418-47184440 GAGGGCAGAAGGGAAATGGCTGG - Intergenic
1043430210 8:80187171-80187193 TAAGGCAGAAGAGGGAGGGCTGG - Intronic
1044422826 8:92017816-92017838 AAGGACAGCACAGGGATGGCAGG - Intronic
1048873312 8:138816365-138816387 TGGGGCAGCACAGTGATGTCAGG - Intronic
1052819845 9:33129842-33129864 GAGGGGAGAACAGAGGTGTCTGG + Intronic
1053933089 9:43126758-43126780 AGTGGCAGAGCAGAGATGGCAGG - Intergenic
1055324185 9:75111394-75111416 TTGGACAGAACAGAGAAGGGTGG + Intronic
1055532754 9:77202727-77202749 TAGGCAAGAAAAGAGAAGGCGGG - Intronic
1055597923 9:77884358-77884380 TATAGCAGAACAGAGAAGTCAGG - Intronic
1056037760 9:82626872-82626894 TAGGGAAGAAAAAACATGGCAGG - Intergenic
1056580734 9:87886805-87886827 TAGGGGAGATCAAAGAGGGCTGG + Exonic
1058559268 9:106206991-106207013 TAAGGCAGAACATAGATTGGTGG - Intergenic
1060030831 9:120213498-120213520 TAGAGGAGAACAGAGGTGGCTGG + Intergenic
1060955291 9:127634442-127634464 TAGAGCAGAACAGATTGGGCTGG + Intronic
1061971353 9:134047134-134047156 TCGGGCAGGACAGACCTGGCTGG - Intronic
1062204170 9:135326523-135326545 TAGGGCTGGACACACATGGCTGG + Intergenic
1186210419 X:7244652-7244674 TAGGGGAGAACAGAGAAGTTGGG + Intronic
1187712508 X:22068228-22068250 TAGAACAGAACAAAGTTGGCTGG - Intronic
1188320676 X:28733334-28733356 AAGGGGAGAAAAGAAATGGCAGG - Intronic
1188555772 X:31410576-31410598 GAGGGCAAAACAAAGATGACAGG - Intronic
1188977105 X:36688964-36688986 TGGGGCAGACCACAGAGGGCTGG + Intergenic
1190812414 X:53897275-53897297 TAGAGGAGCACAGACATGGCAGG + Intergenic
1192314518 X:70041608-70041630 AAGGGCAGAAAAGAGCTGGAAGG + Exonic
1192805708 X:74506646-74506668 TAGGGCAGAAGGGAGATCTCAGG + Intronic
1192855570 X:75006952-75006974 TAGGACAGAATAGAGAATGCAGG - Intergenic
1194067272 X:89276981-89277003 CAGGGCTGAACCGAGATGGTCGG + Intergenic
1196850334 X:119931700-119931722 TAGGGAAGAAAACAGAGGGCAGG + Intronic
1197561219 X:128024571-128024593 TAGTGCAGAACAGAAATGTGGGG - Intergenic
1198195525 X:134357080-134357102 AAGGGCACAACACAGATGGGTGG + Intergenic
1199193464 X:144998747-144998769 TAGGGAAGAACAAAGTTGGAGGG - Intergenic
1200275933 X:154732659-154732681 GAGGGAAGAAAAGAGATGACAGG + Intronic
1200721432 Y:6611195-6611217 CAGGGCTGAACCGAGATGGTCGG + Intergenic
1201583793 Y:15538194-15538216 TAGGGGAGAACAGAGAGGGTTGG + Intergenic