ID: 900805893

View in Genome Browser
Species Human (GRCh38)
Location 1:4768204-4768226
Sequence GTGAGCAGTACTAGTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900805889_900805893 16 Left 900805889 1:4768165-4768187 CCTTTATTCAGGGGGCATCGGAG 0: 1
1: 0
2: 1
3: 2
4: 55
Right 900805893 1:4768204-4768226 GTGAGCAGTACTAGTGCTGCAGG 0: 1
1: 0
2: 0
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900805893 Original CRISPR GTGAGCAGTACTAGTGCTGC AGG Intronic
900805893 1:4768204-4768226 GTGAGCAGTACTAGTGCTGCAGG + Intronic
900878488 1:5363578-5363600 GTGAGCAGTGCATGTGCTCCAGG - Intergenic
904856242 1:33500104-33500126 GCTAGCAGTAATAGTGATGCTGG - Intergenic
911198135 1:95016740-95016762 GTGGGCAGTAGCAGTGCTGAGGG - Intronic
913369402 1:118081649-118081671 GAAAGCAGAACCAGTGCTGCTGG + Intronic
916546469 1:165809947-165809969 GTGACCATTAATGGTGCTGCAGG + Intronic
919073719 1:192789069-192789091 GTGAGCTGCAATAGTGCTGTAGG - Intergenic
922561481 1:226572769-226572791 GTCCGCGGTACTAGTTCTGCAGG + Intronic
923193532 1:231642470-231642492 GTGAGTATCTCTAGTGCTGCTGG + Intronic
1067660189 10:48231361-48231383 GCGAGCTGTCCTTGTGCTGCTGG - Intronic
1070639262 10:78154812-78154834 GTGAGCAGAATTAGGCCTGCAGG + Intergenic
1071382667 10:85083796-85083818 GTGAGGAGCACTAATGCTGGAGG + Intergenic
1071694061 10:87853448-87853470 GTTATCAATACTAGGGCTGCTGG - Intergenic
1072429667 10:95359783-95359805 CTGAGCAATACTATTGCTTCTGG + Intronic
1073612975 10:104962594-104962616 GTGAGCACAACTCGTGGTGCAGG - Intronic
1074211432 10:111339092-111339114 CTCAGCAGTATTGGTGCTGCAGG + Intergenic
1074979742 10:118609987-118610009 GTGAACAGTCCAAGTGCTTCTGG + Intergenic
1075544880 10:123347552-123347574 GTGAGGACTTCTAGTGCTGCAGG + Intergenic
1075728700 10:124623648-124623670 GTGTGCAGTCCTGGGGCTGCGGG - Intronic
1076220658 10:128730701-128730723 GTGAGCAGGACCAGGCCTGCAGG + Intergenic
1081404816 11:42684896-42684918 GTGAGCACTAGTGGTGCTCCTGG - Intergenic
1083642201 11:64151471-64151493 GTCAGCAGTCATCGTGCTGCAGG - Intronic
1084998946 11:73011427-73011449 GTTAGCAGTGTAAGTGCTGCTGG - Intronic
1090949236 11:131458227-131458249 ATCAACAGTACAAGTGCTGCTGG + Intronic
1093355140 12:18157832-18157854 GTGAGCACAACTAGTGCTGTGGG - Intronic
1098496466 12:71141572-71141594 GTGACCAGCACTTGTGCAGCAGG + Intronic
1104948148 12:132426491-132426513 GTGAGCAGGACACGTGCTCCAGG + Intergenic
1106422644 13:29596033-29596055 CTGGCCAGAACTAGTGCTGCAGG + Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG + Intergenic
1115799427 14:36975924-36975946 GTAAGCAGTGCTACTGTTGCGGG + Intronic
1116044713 14:39730637-39730659 TTTAGCAGTACTTGTGGTGCTGG + Intergenic
1116348732 14:43831133-43831155 GTCATCAACACTAGTGCTGCTGG + Intergenic
1119968182 14:78940233-78940255 ATGTGCAGAACTAGTGCTCCAGG - Intronic
1122411020 14:101526259-101526281 GTGAGCATTCCTGGTACTGCTGG + Intergenic
1127137657 15:55941618-55941640 GTGAGCTGAAATTGTGCTGCTGG - Intronic
1128197248 15:65770082-65770104 GTGAGCAGAAATAGAGCAGCAGG - Intronic
1138392048 16:56677016-56677038 GTGAGCAGTGAGTGTGCTGCAGG - Intronic
1139916481 16:70431350-70431372 CTGAGCAGTCCTAGCCCTGCGGG - Intronic
1140666029 16:77228382-77228404 GCTAGCAGTACTGCTGCTGCTGG + Intergenic
1141440355 16:84025936-84025958 GTGAGCCCCACAAGTGCTGCGGG - Intronic
1142676140 17:1514533-1514555 ATCAGCAGCACCAGTGCTGCCGG - Intronic
1147918820 17:43904126-43904148 GTGACCCGTACTATTGCTGGAGG - Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148941047 17:51211449-51211471 GTGAGCTGTAATCGTGCTACTGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151315575 17:73319995-73320017 GTGAGGATTACTAGAGCTGATGG + Intergenic
1152890588 17:82879527-82879549 GTGAGCCCTTCTGGTGCTGCTGG + Intronic
1155325690 18:24662734-24662756 GAGAGCAGAGCTAGAGCTGCAGG - Intergenic
1158321060 18:56265031-56265053 GAGTGCAGTACTAGTCCTCCCGG - Intergenic
1168016558 19:53578294-53578316 GAGAGCAGGAGTAGTGATGCTGG + Exonic
1168371795 19:55841560-55841582 GTTATTAGTAATAGTGCTGCAGG + Intronic
925724687 2:6861650-6861672 GTGAGCAGTAGCTGGGCTGCCGG - Intronic
926701256 2:15805336-15805358 GTGAGCAGTTCTAGGTATGCTGG + Intergenic
927233096 2:20844583-20844605 GTCAGCAGTACTCCTGCTGAGGG - Intergenic
931172302 2:59816223-59816245 GTGAGCAGTAACAATGGTGCTGG + Intergenic
934608100 2:95713326-95713348 CTGAGAAGTACTAGGGCTGAAGG + Intergenic
936541436 2:113355213-113355235 CTGAGAAGTACTAGGGCTGAAGG + Intergenic
940131520 2:150387985-150388007 GTGAGCAGTTCTCTGGCTGCTGG + Intergenic
941421312 2:165285801-165285823 GTGGGCAGTAGGAGTGCTGCAGG + Intronic
1169299905 20:4432875-4432897 GGGAGCAGTGTTAGTGCAGCTGG + Intergenic
1173415725 20:42854064-42854086 GTGAGCCGTAATGGTACTGCAGG - Intronic
1175176048 20:57112728-57112750 TTTAGCAGTGCTAGTGCAGCCGG - Intergenic
1176549676 21:8215747-8215769 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1176557567 21:8259976-8259998 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1176568601 21:8398781-8398803 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1176576512 21:8443010-8443032 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1203254562 22_KI270733v1_random:132068-132090 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1203262618 22_KI270733v1_random:177147-177169 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
959481675 3:106880458-106880480 GTAAGCAATACTAGTGCTGTGGG - Intergenic
961660506 3:128466368-128466390 GGGAGCAGTGTTGGTGCTGCTGG + Exonic
978298425 4:107236526-107236548 GTAAGCAGAATTGGTGCTGCTGG - Intronic
978335529 4:107664417-107664439 GTGAGCTGAACTAGGGATGCTGG - Intronic
980282496 4:130738479-130738501 GTGGGCAGAACAAGTGCGGCAGG + Intergenic
983939393 4:173524664-173524686 GTGACCAGGCCTAGTGTTGCTGG + Intergenic
987815859 5:22900872-22900894 GTGAGCAGAACGAGTCCAGCAGG - Intergenic
990624888 5:57599612-57599634 AATAGCAGTACTAGTGCTGAGGG - Intergenic
995167677 5:109065027-109065049 GTGAGCAGGACTAGTGTAACTGG + Intronic
995834705 5:116388586-116388608 GAGAGCATTAATAGAGCTGCGGG - Intronic
1001015400 5:168136492-168136514 GTGAGCACCAATGGTGCTGCTGG - Intronic
1001766694 5:174254201-174254223 GTGAGCAGTCTTTATGCTGCAGG + Intergenic
1006729866 6:36228835-36228857 GTGAGCAGTGCCCCTGCTGCAGG - Intronic
1017510225 6:155107834-155107856 TTCAGCAGTACTTGTGCTTCTGG - Intronic
1017784300 6:157742088-157742110 GTTAGCAGTGCTATTACTGCTGG - Intronic
1018545301 6:164929187-164929209 GTGTGCAGTCCTAGTCTTGCTGG - Intergenic
1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG + Intronic
1030016594 7:105228945-105228967 GTGAGCAGTAGTTATGATGCAGG - Intronic
1031298271 7:120032930-120032952 GTGTGAAGCATTAGTGCTGCTGG - Intergenic
1039424858 8:37477407-37477429 GTGAGCAGCAATAGAGCTCCTGG - Intergenic
1039581646 8:38671548-38671570 GTGCGCAGTCCTCGTGCAGCAGG + Intergenic
1041282003 8:56219672-56219694 GGGGGCAGAACTAGAGCTGCAGG + Intergenic
1044292060 8:90483807-90483829 TTCAGCAGTACTTGTGGTGCTGG - Intergenic
1047361762 8:124175628-124175650 GGGAGCAGAACTGGGGCTGCTGG - Intergenic
1048492010 8:134902602-134902624 GTGAGCAGGACAAGTTCTGTGGG - Intergenic
1052940261 9:34126965-34126987 GTGAGGACCACCAGTGCTGCTGG + Intronic
1061879407 9:133561284-133561306 GTGACCAGTACCTGTGGTGCAGG - Exonic
1062687776 9:137824298-137824320 ATAAGCAGAACTAGTGGTGCTGG - Intronic
1203470963 Un_GL000220v1:115212-115234 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1203478784 Un_GL000220v1:159184-159206 GTAAGCAGAACTGGCGCTGCGGG + Intergenic
1195127646 X:101823545-101823567 GTGAGCAGAATGAGTGCAGCAGG + Intergenic