ID: 900806573

View in Genome Browser
Species Human (GRCh38)
Location 1:4771524-4771546
Sequence CACAGGAAGGACAAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2311
Summary {0: 1, 1: 0, 2: 16, 3: 428, 4: 1866}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900806573_900806583 4 Left 900806573 1:4771524-4771546 CCAGCCCCCTTGTCCTTCCTGTG 0: 1
1: 0
2: 16
3: 428
4: 1866
Right 900806583 1:4771551-4771573 CATCATAGAAGTGGCATCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 64
900806573_900806584 5 Left 900806573 1:4771524-4771546 CCAGCCCCCTTGTCCTTCCTGTG 0: 1
1: 0
2: 16
3: 428
4: 1866
Right 900806584 1:4771552-4771574 ATCATAGAAGTGGCATCCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 57
900806573_900806580 -5 Left 900806573 1:4771524-4771546 CCAGCCCCCTTGTCCTTCCTGTG 0: 1
1: 0
2: 16
3: 428
4: 1866
Right 900806580 1:4771542-4771564 CTGTGCTCTCATCATAGAAGTGG 0: 1
1: 0
2: 1
3: 13
4: 170
900806573_900806582 3 Left 900806573 1:4771524-4771546 CCAGCCCCCTTGTCCTTCCTGTG 0: 1
1: 0
2: 16
3: 428
4: 1866
Right 900806582 1:4771550-4771572 TCATCATAGAAGTGGCATCCGGG 0: 1
1: 0
2: 0
3: 6
4: 115
900806573_900806581 2 Left 900806573 1:4771524-4771546 CCAGCCCCCTTGTCCTTCCTGTG 0: 1
1: 0
2: 16
3: 428
4: 1866
Right 900806581 1:4771549-4771571 CTCATCATAGAAGTGGCATCCGG 0: 1
1: 0
2: 1
3: 14
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900806573 Original CRISPR CACAGGAAGGACAAGGGGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr