ID: 900811370

View in Genome Browser
Species Human (GRCh38)
Location 1:4803797-4803819
Sequence CTGAGCAAACAGCTCAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900811370_900811371 -4 Left 900811370 1:4803797-4803819 CCATGCTTGAGCTGTTTGCTCAG No data
Right 900811371 1:4803816-4803838 TCAGCATAAATTATCCTCCCAGG No data
900811370_900811372 1 Left 900811370 1:4803797-4803819 CCATGCTTGAGCTGTTTGCTCAG No data
Right 900811372 1:4803821-4803843 ATAAATTATCCTCCCAGGAAAGG No data
900811370_900811377 20 Left 900811370 1:4803797-4803819 CCATGCTTGAGCTGTTTGCTCAG No data
Right 900811377 1:4803840-4803862 AAGGTATTTCATATTCTCCAGGG No data
900811370_900811376 19 Left 900811370 1:4803797-4803819 CCATGCTTGAGCTGTTTGCTCAG No data
Right 900811376 1:4803839-4803861 AAAGGTATTTCATATTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900811370 Original CRISPR CTGAGCAAACAGCTCAAGCA TGG (reversed) Intergenic
No off target data available for this crispr