ID: 900812683

View in Genome Browser
Species Human (GRCh38)
Location 1:4819732-4819754
Sequence GTGGCCATCTGGTCTGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900812676_900812683 14 Left 900812676 1:4819695-4819717 CCTTCTGCATCAAAGATGTAACA No data
Right 900812683 1:4819732-4819754 GTGGCCATCTGGTCTGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900812683 Original CRISPR GTGGCCATCTGGTCTGAGTT AGG Intergenic
No off target data available for this crispr