ID: 900819266

View in Genome Browser
Species Human (GRCh38)
Location 1:4873649-4873671
Sequence CTGTGCACGGCAGGTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900819266_900819272 4 Left 900819266 1:4873649-4873671 CCAATGCCACCTGCCGTGCACAG No data
Right 900819272 1:4873676-4873698 ATTTTTCCAAGCTGAAGCTGTGG No data
900819266_900819273 5 Left 900819266 1:4873649-4873671 CCAATGCCACCTGCCGTGCACAG No data
Right 900819273 1:4873677-4873699 TTTTTCCAAGCTGAAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900819266 Original CRISPR CTGTGCACGGCAGGTGGCAT TGG (reversed) Intergenic
No off target data available for this crispr