ID: 900821762

View in Genome Browser
Species Human (GRCh38)
Location 1:4895223-4895245
Sequence CTTTTTCTGCAGGAGGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900821756_900821762 -1 Left 900821756 1:4895201-4895223 CCGAATTTCTCCCACCTCAGTAC No data
Right 900821762 1:4895223-4895245 CTTTTTCTGCAGGAGGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900821762 Original CRISPR CTTTTTCTGCAGGAGGTAGC AGG Intergenic
No off target data available for this crispr