ID: 900823069

View in Genome Browser
Species Human (GRCh38)
Location 1:4905002-4905024
Sequence TCTGCTCCTTCTGTGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900823063_900823069 15 Left 900823063 1:4904964-4904986 CCTGCCAGCTAATATTTTTTGTA No data
Right 900823069 1:4905002-4905024 TCTGCTCCTTCTGTGGTCCCTGG No data
900823064_900823069 11 Left 900823064 1:4904968-4904990 CCAGCTAATATTTTTTGTACACT No data
Right 900823069 1:4905002-4905024 TCTGCTCCTTCTGTGGTCCCTGG No data
900823062_900823069 26 Left 900823062 1:4904953-4904975 CCTGTGACAAACCTGCCAGCTAA No data
Right 900823069 1:4905002-4905024 TCTGCTCCTTCTGTGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900823069 Original CRISPR TCTGCTCCTTCTGTGGTCCC TGG Intergenic
No off target data available for this crispr