ID: 900823809

View in Genome Browser
Species Human (GRCh38)
Location 1:4910492-4910514
Sequence CTCTGGACACTGAGGCTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900823809_900823818 25 Left 900823809 1:4910492-4910514 CCACGAAGCCTCAGTGTCCAGAG No data
Right 900823818 1:4910540-4910562 GCATGATTAATCTTGGGACAAGG No data
900823809_900823816 18 Left 900823809 1:4910492-4910514 CCACGAAGCCTCAGTGTCCAGAG No data
Right 900823816 1:4910533-4910555 TGTGTAGGCATGATTAATCTTGG No data
900823809_900823819 26 Left 900823809 1:4910492-4910514 CCACGAAGCCTCAGTGTCCAGAG No data
Right 900823819 1:4910541-4910563 CATGATTAATCTTGGGACAAGGG No data
900823809_900823815 3 Left 900823809 1:4910492-4910514 CCACGAAGCCTCAGTGTCCAGAG No data
Right 900823815 1:4910518-4910540 CAACTGGGATTTCTCTGTGTAGG No data
900823809_900823817 19 Left 900823809 1:4910492-4910514 CCACGAAGCCTCAGTGTCCAGAG No data
Right 900823817 1:4910534-4910556 GTGTAGGCATGATTAATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900823809 Original CRISPR CTCTGGACACTGAGGCTTCG TGG (reversed) Intergenic