ID: 900823811

View in Genome Browser
Species Human (GRCh38)
Location 1:4910500-4910522
Sequence AGTTGAGCCTCTGGACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900823811_900823818 17 Left 900823811 1:4910500-4910522 CCTCAGTGTCCAGAGGCTCAACT No data
Right 900823818 1:4910540-4910562 GCATGATTAATCTTGGGACAAGG No data
900823811_900823816 10 Left 900823811 1:4910500-4910522 CCTCAGTGTCCAGAGGCTCAACT No data
Right 900823816 1:4910533-4910555 TGTGTAGGCATGATTAATCTTGG No data
900823811_900823819 18 Left 900823811 1:4910500-4910522 CCTCAGTGTCCAGAGGCTCAACT No data
Right 900823819 1:4910541-4910563 CATGATTAATCTTGGGACAAGGG No data
900823811_900823817 11 Left 900823811 1:4910500-4910522 CCTCAGTGTCCAGAGGCTCAACT No data
Right 900823817 1:4910534-4910556 GTGTAGGCATGATTAATCTTGGG No data
900823811_900823815 -5 Left 900823811 1:4910500-4910522 CCTCAGTGTCCAGAGGCTCAACT No data
Right 900823815 1:4910518-4910540 CAACTGGGATTTCTCTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900823811 Original CRISPR AGTTGAGCCTCTGGACACTG AGG (reversed) Intergenic