ID: 900823814

View in Genome Browser
Species Human (GRCh38)
Location 1:4910509-4910531
Sequence AGAAATCCCAGTTGAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900823814_900823819 9 Left 900823814 1:4910509-4910531 CCAGAGGCTCAACTGGGATTTCT No data
Right 900823819 1:4910541-4910563 CATGATTAATCTTGGGACAAGGG No data
900823814_900823818 8 Left 900823814 1:4910509-4910531 CCAGAGGCTCAACTGGGATTTCT No data
Right 900823818 1:4910540-4910562 GCATGATTAATCTTGGGACAAGG No data
900823814_900823817 2 Left 900823814 1:4910509-4910531 CCAGAGGCTCAACTGGGATTTCT No data
Right 900823817 1:4910534-4910556 GTGTAGGCATGATTAATCTTGGG No data
900823814_900823816 1 Left 900823814 1:4910509-4910531 CCAGAGGCTCAACTGGGATTTCT No data
Right 900823816 1:4910533-4910555 TGTGTAGGCATGATTAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900823814 Original CRISPR AGAAATCCCAGTTGAGCCTC TGG (reversed) Intergenic