ID: 900823815

View in Genome Browser
Species Human (GRCh38)
Location 1:4910518-4910540
Sequence CAACTGGGATTTCTCTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900823811_900823815 -5 Left 900823811 1:4910500-4910522 CCTCAGTGTCCAGAGGCTCAACT No data
Right 900823815 1:4910518-4910540 CAACTGGGATTTCTCTGTGTAGG No data
900823809_900823815 3 Left 900823809 1:4910492-4910514 CCACGAAGCCTCAGTGTCCAGAG No data
Right 900823815 1:4910518-4910540 CAACTGGGATTTCTCTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900823815 Original CRISPR CAACTGGGATTTCTCTGTGT AGG Intergenic
No off target data available for this crispr