ID: 900823819

View in Genome Browser
Species Human (GRCh38)
Location 1:4910541-4910563
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900823811_900823819 18 Left 900823811 1:4910500-4910522 CCTCAGTGTCCAGAGGCTCAACT No data
Right 900823819 1:4910541-4910563 CATGATTAATCTTGGGACAAGGG No data
900823814_900823819 9 Left 900823814 1:4910509-4910531 CCAGAGGCTCAACTGGGATTTCT No data
Right 900823819 1:4910541-4910563 CATGATTAATCTTGGGACAAGGG No data
900823809_900823819 26 Left 900823809 1:4910492-4910514 CCACGAAGCCTCAGTGTCCAGAG No data
Right 900823819 1:4910541-4910563 CATGATTAATCTTGGGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr