ID: 900826735

View in Genome Browser
Species Human (GRCh38)
Location 1:4933014-4933036
Sequence GCCCTTGAGAAACACGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900826735_900826744 26 Left 900826735 1:4933014-4933036 CCTTCCCCGTGTTTCTCAAGGGC No data
Right 900826744 1:4933063-4933085 TGAATCCATTCTCTCCTGGGAGG No data
900826735_900826742 22 Left 900826735 1:4933014-4933036 CCTTCCCCGTGTTTCTCAAGGGC No data
Right 900826742 1:4933059-4933081 AGAGTGAATCCATTCTCTCCTGG No data
900826735_900826740 -5 Left 900826735 1:4933014-4933036 CCTTCCCCGTGTTTCTCAAGGGC No data
Right 900826740 1:4933032-4933054 AGGGCAGGATCAACACCTGCAGG No data
900826735_900826745 27 Left 900826735 1:4933014-4933036 CCTTCCCCGTGTTTCTCAAGGGC No data
Right 900826745 1:4933064-4933086 GAATCCATTCTCTCCTGGGAGGG No data
900826735_900826743 23 Left 900826735 1:4933014-4933036 CCTTCCCCGTGTTTCTCAAGGGC No data
Right 900826743 1:4933060-4933082 GAGTGAATCCATTCTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900826735 Original CRISPR GCCCTTGAGAAACACGGGGA AGG (reversed) Intergenic
No off target data available for this crispr