ID: 900829137

View in Genome Browser
Species Human (GRCh38)
Location 1:4951656-4951678
Sequence TTTTCCTGTACCTTTTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900829137_900829139 -8 Left 900829137 1:4951656-4951678 CCCATGAAAAAGGTACAGGAAAA No data
Right 900829139 1:4951671-4951693 CAGGAAAATGCAGCATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900829137 Original CRISPR TTTTCCTGTACCTTTTTCAT GGG (reversed) Intergenic
No off target data available for this crispr