ID: 900829138

View in Genome Browser
Species Human (GRCh38)
Location 1:4951657-4951679
Sequence ATTTTCCTGTACCTTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900829138_900829139 -9 Left 900829138 1:4951657-4951679 CCATGAAAAAGGTACAGGAAAAT No data
Right 900829139 1:4951671-4951693 CAGGAAAATGCAGCATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900829138 Original CRISPR ATTTTCCTGTACCTTTTTCA TGG (reversed) Intergenic
No off target data available for this crispr