ID: 900829139

View in Genome Browser
Species Human (GRCh38)
Location 1:4951671-4951693
Sequence CAGGAAAATGCAGCATGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900829138_900829139 -9 Left 900829138 1:4951657-4951679 CCATGAAAAAGGTACAGGAAAAT No data
Right 900829139 1:4951671-4951693 CAGGAAAATGCAGCATGTGTTGG No data
900829137_900829139 -8 Left 900829137 1:4951656-4951678 CCCATGAAAAAGGTACAGGAAAA No data
Right 900829139 1:4951671-4951693 CAGGAAAATGCAGCATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900829139 Original CRISPR CAGGAAAATGCAGCATGTGT TGG Intergenic
No off target data available for this crispr