ID: 900832293

View in Genome Browser
Species Human (GRCh38)
Location 1:4973811-4973833
Sequence GGGTCAGCACCCTGTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900832293_900832298 1 Left 900832293 1:4973811-4973833 CCTGCTCCACAGGGTGCTGACCC No data
Right 900832298 1:4973835-4973857 GCCACCAAGCTGAGATCTTGTGG No data
900832293_900832302 8 Left 900832293 1:4973811-4973833 CCTGCTCCACAGGGTGCTGACCC No data
Right 900832302 1:4973842-4973864 AGCTGAGATCTTGTGGCCCAGGG No data
900832293_900832304 23 Left 900832293 1:4973811-4973833 CCTGCTCCACAGGGTGCTGACCC No data
Right 900832304 1:4973857-4973879 GCCCAGGGACCTGCATCCCAGGG No data
900832293_900832303 22 Left 900832293 1:4973811-4973833 CCTGCTCCACAGGGTGCTGACCC No data
Right 900832303 1:4973856-4973878 GGCCCAGGGACCTGCATCCCAGG No data
900832293_900832301 7 Left 900832293 1:4973811-4973833 CCTGCTCCACAGGGTGCTGACCC No data
Right 900832301 1:4973841-4973863 AAGCTGAGATCTTGTGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900832293 Original CRISPR GGGTCAGCACCCTGTGGAGC AGG (reversed) Intergenic
No off target data available for this crispr