ID: 900833805

View in Genome Browser
Species Human (GRCh38)
Location 1:4984844-4984866
Sequence CAGAACTCACAGATGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900833805_900833806 5 Left 900833805 1:4984844-4984866 CCAAGCTGCATCTGTGAGTTCTG No data
Right 900833806 1:4984872-4984894 TTTCACCGAGCCTCCTGACAAGG No data
900833805_900833811 29 Left 900833805 1:4984844-4984866 CCAAGCTGCATCTGTGAGTTCTG No data
Right 900833811 1:4984896-4984918 CTTGCCATGTGTGCGTCCCCAGG No data
900833805_900833812 30 Left 900833805 1:4984844-4984866 CCAAGCTGCATCTGTGAGTTCTG No data
Right 900833812 1:4984897-4984919 TTGCCATGTGTGCGTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900833805 Original CRISPR CAGAACTCACAGATGCAGCT TGG (reversed) Intergenic
No off target data available for this crispr