ID: 900834076

View in Genome Browser
Species Human (GRCh38)
Location 1:4986437-4986459
Sequence CTTGTCGAGGCCATGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900834076_900834078 -10 Left 900834076 1:4986437-4986459 CCATTTTTCATGGCCTCGACAAG No data
Right 900834078 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
900834076_900834081 26 Left 900834076 1:4986437-4986459 CCATTTTTCATGGCCTCGACAAG No data
Right 900834081 1:4986486-4986508 AGCAGAGGTTACCTTGAGCAGGG No data
900834076_900834079 11 Left 900834076 1:4986437-4986459 CCATTTTTCATGGCCTCGACAAG No data
Right 900834079 1:4986471-4986493 GGCACATAATGAGTCAGCAGAGG No data
900834076_900834080 25 Left 900834076 1:4986437-4986459 CCATTTTTCATGGCCTCGACAAG No data
Right 900834080 1:4986485-4986507 CAGCAGAGGTTACCTTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900834076 Original CRISPR CTTGTCGAGGCCATGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr