ID: 900834077

View in Genome Browser
Species Human (GRCh38)
Location 1:4986450-4986472
Sequence CCTGATAAGATCTCTTGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900834077_900834079 -2 Left 900834077 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
Right 900834079 1:4986471-4986493 GGCACATAATGAGTCAGCAGAGG No data
900834077_900834080 12 Left 900834077 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
Right 900834080 1:4986485-4986507 CAGCAGAGGTTACCTTGAGCAGG No data
900834077_900834081 13 Left 900834077 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
Right 900834081 1:4986486-4986508 AGCAGAGGTTACCTTGAGCAGGG No data
900834077_900834083 28 Left 900834077 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
Right 900834083 1:4986501-4986523 GAGCAGGGACCACAGACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900834077 Original CRISPR CCTGATAAGATCTCTTGTCG AGG (reversed) Intergenic
No off target data available for this crispr