ID: 900834078

View in Genome Browser
Species Human (GRCh38)
Location 1:4986450-4986472
Sequence CCTCGACAAGAGATCTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900834071_900834078 25 Left 900834071 1:4986402-4986424 CCTTCGCTCAGCCCGGCTTGCAT No data
Right 900834078 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
900834070_900834078 29 Left 900834070 1:4986398-4986420 CCTTCCTTCGCTCAGCCCGGCTT No data
Right 900834078 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
900834076_900834078 -10 Left 900834076 1:4986437-4986459 CCATTTTTCATGGCCTCGACAAG No data
Right 900834078 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
900834069_900834078 30 Left 900834069 1:4986397-4986419 CCCTTCCTTCGCTCAGCCCGGCT No data
Right 900834078 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
900834072_900834078 14 Left 900834072 1:4986413-4986435 CCCGGCTTGCATCTCAGTACAAG No data
Right 900834078 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
900834073_900834078 13 Left 900834073 1:4986414-4986436 CCGGCTTGCATCTCAGTACAAGG No data
Right 900834078 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900834078 Original CRISPR CCTCGACAAGAGATCTTATC AGG Intergenic
No off target data available for this crispr