ID: 900834079

View in Genome Browser
Species Human (GRCh38)
Location 1:4986471-4986493
Sequence GGCACATAATGAGTCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900834077_900834079 -2 Left 900834077 1:4986450-4986472 CCTCGACAAGAGATCTTATCAGG No data
Right 900834079 1:4986471-4986493 GGCACATAATGAGTCAGCAGAGG No data
900834076_900834079 11 Left 900834076 1:4986437-4986459 CCATTTTTCATGGCCTCGACAAG No data
Right 900834079 1:4986471-4986493 GGCACATAATGAGTCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900834079 Original CRISPR GGCACATAATGAGTCAGCAG AGG Intergenic
No off target data available for this crispr